Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638282_at:

>probe:Drosophila_2:1638282_at:711:285; Interrogation_Position=1252; Antisense; CTGGTGGCCGGACTGACCATCATAA
>probe:Drosophila_2:1638282_at:711:133; Interrogation_Position=1306; Antisense; ACGCCCTTCATTCTGGTGGACTTTG
>probe:Drosophila_2:1638282_at:534:403; Interrogation_Position=1324; Antisense; GACTTTGGCTTCGATACTCCACAGA
>probe:Drosophila_2:1638282_at:584:153; Interrogation_Position=1344; Antisense; ACAGATTACGCTGGCCATGTCGCTG
>probe:Drosophila_2:1638282_at:31:623; Interrogation_Position=1367; Antisense; TGCTGGCGGGACTGGACATCACCAT
>probe:Drosophila_2:1638282_at:441:525; Interrogation_Position=1430; Antisense; GGGACAACCGGGTATTCTTCCTCAT
>probe:Drosophila_2:1638282_at:316:117; Interrogation_Position=1525; Antisense; AGCTTCGTGTGGATCGGTCTCTGCA
>probe:Drosophila_2:1638282_at:681:221; Interrogation_Position=1549; Antisense; AAGGGAGTGCGTACCATCTTCTGGC
>probe:Drosophila_2:1638282_at:386:615; Interrogation_Position=1628; Antisense; TGCAACTGCTGATCTCGGGACTATT
>probe:Drosophila_2:1638282_at:138:605; Interrogation_Position=1658; Antisense; TGATCGGTGGTCCATTTGTCGGCCT
>probe:Drosophila_2:1638282_at:646:315; Interrogation_Position=1679; Antisense; GCCTGGTGCGTGACCGTTACGACTA
>probe:Drosophila_2:1638282_at:229:475; Interrogation_Position=1694; Antisense; GTTACGACTATTCGGTTACCCTGCA
>probe:Drosophila_2:1638282_at:61:673; Interrogation_Position=1710; Antisense; TACCCTGCACTGTCTCAATATGATG
>probe:Drosophila_2:1638282_at:565:681; Interrogation_Position=1728; Antisense; TATGATGTCCTTTGTGGCAGCAACA

Paste this into a BLAST search page for me
CTGGTGGCCGGACTGACCATCATAAACGCCCTTCATTCTGGTGGACTTTGGACTTTGGCTTCGATACTCCACAGAACAGATTACGCTGGCCATGTCGCTGTGCTGGCGGGACTGGACATCACCATGGGACAACCGGGTATTCTTCCTCATAGCTTCGTGTGGATCGGTCTCTGCAAAGGGAGTGCGTACCATCTTCTGGCTGCAACTGCTGATCTCGGGACTATTTGATCGGTGGTCCATTTGTCGGCCTGCCTGGTGCGTGACCGTTACGACTAGTTACGACTATTCGGTTACCCTGCATACCCTGCACTGTCTCAATATGATGTATGATGTCCTTTGTGGCAGCAACA

Full Affymetrix probeset data:

Annotations for 1638282_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime