Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638283_at:

>probe:Drosophila_2:1638283_at:393:253; Interrogation_Position=2407; Antisense; CACGGTTTCGGGACTGGAACTGCGC
>probe:Drosophila_2:1638283_at:586:383; Interrogation_Position=2423; Antisense; GAACTGCGCTTCGATGTGGAGAACG
>probe:Drosophila_2:1638283_at:416:635; Interrogation_Position=2476; Antisense; TCGGAAGGCTTCTACTCTCAACAAT
>probe:Drosophila_2:1638283_at:145:651; Interrogation_Position=2493; Antisense; TCAACAATCTTACTGCCTTTGGCCA
>probe:Drosophila_2:1638283_at:620:437; Interrogation_Position=2525; Antisense; GAGGAAACTGCTGACTCCCTGGACT
>probe:Drosophila_2:1638283_at:447:149; Interrogation_Position=2568; Antisense; ACTTGACCCAACTAGGACCATCGAT
>probe:Drosophila_2:1638283_at:722:607; Interrogation_Position=2602; Antisense; TGAGATCAAATCTCTGCACCCGGAG
>probe:Drosophila_2:1638283_at:567:335; Interrogation_Position=2650; Antisense; GCTGCAGTTCCTCAAACTCGTTAAG
>probe:Drosophila_2:1638283_at:148:607; Interrogation_Position=2701; Antisense; TGAGCTGGCTCAATCGTATCTAAGC
>probe:Drosophila_2:1638283_at:421:483; Interrogation_Position=2716; Antisense; GTATCTAAGCGTCTTCTTGCGATCC
>probe:Drosophila_2:1638283_at:105:397; Interrogation_Position=2736; Antisense; GATCCCACGGTCTCGGGTTGACGGA
>probe:Drosophila_2:1638283_at:261:67; Interrogation_Position=2844; Antisense; ATGGAACTGGAGTTGTGGCCGCTCT
>probe:Drosophila_2:1638283_at:85:339; Interrogation_Position=2864; Antisense; GCTCTCCGAAACTTTGCGCACTAGT
>probe:Drosophila_2:1638283_at:189:325; Interrogation_Position=2879; Antisense; GCGCACTAGTTTCCACCAGATTATG

Paste this into a BLAST search page for me
CACGGTTTCGGGACTGGAACTGCGCGAACTGCGCTTCGATGTGGAGAACGTCGGAAGGCTTCTACTCTCAACAATTCAACAATCTTACTGCCTTTGGCCAGAGGAAACTGCTGACTCCCTGGACTACTTGACCCAACTAGGACCATCGATTGAGATCAAATCTCTGCACCCGGAGGCTGCAGTTCCTCAAACTCGTTAAGTGAGCTGGCTCAATCGTATCTAAGCGTATCTAAGCGTCTTCTTGCGATCCGATCCCACGGTCTCGGGTTGACGGAATGGAACTGGAGTTGTGGCCGCTCTGCTCTCCGAAACTTTGCGCACTAGTGCGCACTAGTTTCCACCAGATTATG

Full Affymetrix probeset data:

Annotations for 1638283_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime