Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638284_at:

>probe:Drosophila_2:1638284_at:188:441; Interrogation_Position=265; Antisense; GATCTTGTTATCACCCGACTGGAGG
>probe:Drosophila_2:1638284_at:393:591; Interrogation_Position=299; Antisense; TGGTCCTGGCCGACGCAAGAAAACT
>probe:Drosophila_2:1638284_at:219:521; Interrogation_Position=344; Antisense; GTGGCAACAATCTCAGTCTTACGGC
>probe:Drosophila_2:1638284_at:496:429; Interrogation_Position=388; Antisense; GAGTTCAAGCCGAATGCCAGTCACA
>probe:Drosophila_2:1638284_at:199:297; Interrogation_Position=431; Antisense; CGAATCTAGCCCAGACAGTCGAAGA
>probe:Drosophila_2:1638284_at:245:537; Interrogation_Position=505; Antisense; GGTAAACTGAGCCTGCCCAAAAGAT
>probe:Drosophila_2:1638284_at:308:55; Interrogation_Position=553; Antisense; ATGAAGGCATTCTCCTACACGAGCA
>probe:Drosophila_2:1638284_at:444:135; Interrogation_Position=571; Antisense; ACGAGCACTTGTCCCCTGGAAATGG
>probe:Drosophila_2:1638284_at:46:315; Interrogation_Position=603; Antisense; GCCAGTTGGCGCATTAGAGTTCCTT
>probe:Drosophila_2:1638284_at:313:429; Interrogation_Position=619; Antisense; GAGTTCCTTTGCAAGCTGTTCATCA
>probe:Drosophila_2:1638284_at:355:389; Interrogation_Position=670; Antisense; GAAACTTGCCCCAATTTGGACAGGA
>probe:Drosophila_2:1638284_at:335:139; Interrogation_Position=689; Antisense; ACAGGAACCTTAGCCCAAGGGACAT
>probe:Drosophila_2:1638284_at:315:691; Interrogation_Position=718; Antisense; TTTGTGGTCGGCAAATCGCAGGCCA
>probe:Drosophila_2:1638284_at:6:451; Interrogation_Position=757; Antisense; GATCCCTGTCGAGATGCTCTGGAAA

Paste this into a BLAST search page for me
GATCTTGTTATCACCCGACTGGAGGTGGTCCTGGCCGACGCAAGAAAACTGTGGCAACAATCTCAGTCTTACGGCGAGTTCAAGCCGAATGCCAGTCACACGAATCTAGCCCAGACAGTCGAAGAGGTAAACTGAGCCTGCCCAAAAGATATGAAGGCATTCTCCTACACGAGCAACGAGCACTTGTCCCCTGGAAATGGGCCAGTTGGCGCATTAGAGTTCCTTGAGTTCCTTTGCAAGCTGTTCATCAGAAACTTGCCCCAATTTGGACAGGAACAGGAACCTTAGCCCAAGGGACATTTTGTGGTCGGCAAATCGCAGGCCAGATCCCTGTCGAGATGCTCTGGAAA

Full Affymetrix probeset data:

Annotations for 1638284_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime