Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638286_at:

>probe:Drosophila_2:1638286_at:267:345; Interrogation_Position=1448; Antisense; GCATTAAACACGATTCCACACTCAC
>probe:Drosophila_2:1638286_at:266:379; Interrogation_Position=1481; Antisense; GAAGCCAGCTTCTCAACGCAGCTAG
>probe:Drosophila_2:1638286_at:70:697; Interrogation_Position=1516; Antisense; TTTCGATTGTCCACAGCCGCAGGAA
>probe:Drosophila_2:1638286_at:51:161; Interrogation_Position=1540; Antisense; ACAAGCTGTGGCGAAAGCTCCCAAC
>probe:Drosophila_2:1638286_at:58:193; Interrogation_Position=1562; Antisense; AACTCACCGTCACTGCCGAAAGAGG
>probe:Drosophila_2:1638286_at:520:665; Interrogation_Position=1599; Antisense; TACTTGTGCTAAAATCGGGCTTTCA
>probe:Drosophila_2:1638286_at:686:233; Interrogation_Position=1623; Antisense; AATGCCCTGGCGAACCATTTTTCTA
>probe:Drosophila_2:1638286_at:706:37; Interrogation_Position=1655; Antisense; ATCTACGAATTTGAGCACGGCACAT
>probe:Drosophila_2:1638286_at:299:273; Interrogation_Position=1693; Antisense; CATTGGTACGTGTGTGCTGCGATTT
>probe:Drosophila_2:1638286_at:684:663; Interrogation_Position=1717; Antisense; TAAAGAGGATGACCCGCGCATTCAG
>probe:Drosophila_2:1638286_at:633:73; Interrogation_Position=1740; Antisense; AGGACACCTCGCAGGCAGCTTTGGA
>probe:Drosophila_2:1638286_at:173:569; Interrogation_Position=1753; Antisense; GGCAGCTTTGGAACGCGTCAACATA
>probe:Drosophila_2:1638286_at:332:265; Interrogation_Position=1782; Antisense; CAGACGATGTATGGTGCCGCAGCGA
>probe:Drosophila_2:1638286_at:277:75; Interrogation_Position=1806; Antisense; AGGACCGCGGCATCTTTGAGCATAT

Paste this into a BLAST search page for me
GCATTAAACACGATTCCACACTCACGAAGCCAGCTTCTCAACGCAGCTAGTTTCGATTGTCCACAGCCGCAGGAAACAAGCTGTGGCGAAAGCTCCCAACAACTCACCGTCACTGCCGAAAGAGGTACTTGTGCTAAAATCGGGCTTTCAAATGCCCTGGCGAACCATTTTTCTAATCTACGAATTTGAGCACGGCACATCATTGGTACGTGTGTGCTGCGATTTTAAAGAGGATGACCCGCGCATTCAGAGGACACCTCGCAGGCAGCTTTGGAGGCAGCTTTGGAACGCGTCAACATACAGACGATGTATGGTGCCGCAGCGAAGGACCGCGGCATCTTTGAGCATAT

Full Affymetrix probeset data:

Annotations for 1638286_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime