FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638288_at:

>probe:Drosophila_2:1638288_at:423:519; Interrogation_Position=160; Antisense; GTGGATCTTCAGAATAATCAGGCCA
>probe:Drosophila_2:1638288_at:241:239; Interrogation_Position=175; Antisense; AATCAGGCCAATTGTCTGCACTGCG
>probe:Drosophila_2:1638288_at:429:143; Interrogation_Position=194; Antisense; ACTGCGGCGAGCTGCATGACAATGA
>probe:Drosophila_2:1638288_at:627:685; Interrogation_Position=250; Antisense; TATAATGCAGAGCTGCAGCCTCCAA
>probe:Drosophila_2:1638288_at:541:347; Interrogation_Position=28; Antisense; GCACTCGAACCGACTAACCCAATAA
>probe:Drosophila_2:1638288_at:21:207; Interrogation_Position=309; Antisense; AAGCGCGCAAACATGTGATATACTC
>probe:Drosophila_2:1638288_at:314:73; Interrogation_Position=337; Antisense; AGGAACTTGTACTTGAAACGCATAT
>probe:Drosophila_2:1638288_at:174:709; Interrogation_Position=394; Antisense; TTAAGTGTATCGCTAGTTTCTAGAT
>probe:Drosophila_2:1638288_at:182:485; Interrogation_Position=431; Antisense; GTATGACATCAATATTGGGAGCCAG
>probe:Drosophila_2:1638288_at:401:589; Interrogation_Position=446; Antisense; TGGGAGCCAGTTATAGGTTTCTAAT
>probe:Drosophila_2:1638288_at:320:695; Interrogation_Position=463; Antisense; TTTCTAATCCTAAGATGCCCACTGC
>probe:Drosophila_2:1638288_at:165:661; Interrogation_Position=50; Antisense; TAACAAAACACCACAAACCTCAGAG
>probe:Drosophila_2:1638288_at:587:201; Interrogation_Position=65; Antisense; AACCTCAGAGGCCAAGGAACGCTGC
>probe:Drosophila_2:1638288_at:202:563; Interrogation_Position=80; Antisense; GGAACGCTGCTCACATGGAGACTGT

Paste this into a BLAST search page for me
GTGGATCTTCAGAATAATCAGGCCAAATCAGGCCAATTGTCTGCACTGCGACTGCGGCGAGCTGCATGACAATGATATAATGCAGAGCTGCAGCCTCCAAGCACTCGAACCGACTAACCCAATAAAAGCGCGCAAACATGTGATATACTCAGGAACTTGTACTTGAAACGCATATTTAAGTGTATCGCTAGTTTCTAGATGTATGACATCAATATTGGGAGCCAGTGGGAGCCAGTTATAGGTTTCTAATTTTCTAATCCTAAGATGCCCACTGCTAACAAAACACCACAAACCTCAGAGAACCTCAGAGGCCAAGGAACGCTGCGGAACGCTGCTCACATGGAGACTGT

Full Affymetrix probeset data:

Annotations for 1638288_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720