Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638290_at:

>probe:Drosophila_2:1638290_at:85:403; Interrogation_Position=1237; Antisense; GACTTCGCCTGAGTGAAACCCGGAT
>probe:Drosophila_2:1638290_at:324:159; Interrogation_Position=1289; Antisense; ACAAGCGGCGCCAATTTTACATTTT
>probe:Drosophila_2:1638290_at:401:313; Interrogation_Position=1341; Antisense; GCCTAATTTATGTGCGTTCTCGAAA
>probe:Drosophila_2:1638290_at:366:117; Interrogation_Position=1383; Antisense; AGCGGTTAAAGCTTACTGATCCTAA
>probe:Drosophila_2:1638290_at:696:603; Interrogation_Position=1399; Antisense; TGATCCTAACTCTCAAAACCACAAC
>probe:Drosophila_2:1638290_at:6:203; Interrogation_Position=1415; Antisense; AACCACAACTAAATGCTGCGTCGCG
>probe:Drosophila_2:1638290_at:526:621; Interrogation_Position=1431; Antisense; TGCGTCGCGTATAATCAGCCCAAGG
>probe:Drosophila_2:1638290_at:283:679; Interrogation_Position=1482; Antisense; TATGTGTCGTACGTCTAACCACTGC
>probe:Drosophila_2:1638290_at:684:283; Interrogation_Position=1510; Antisense; CTGCTCCAGATTCAGATTGCTCGGA
>probe:Drosophila_2:1638290_at:148:573; Interrogation_Position=1581; Antisense; GGCGGCCAGTTGTTAACTTGTCTTA
>probe:Drosophila_2:1638290_at:454:661; Interrogation_Position=1594; Antisense; TAACTTGTCTTACTCACGTGCCAGA
>probe:Drosophila_2:1638290_at:421:291; Interrogation_Position=1610; Antisense; CGTGCCAGACGTTGTAGTTGTTACT
>probe:Drosophila_2:1638290_at:171:239; Interrogation_Position=1671; Antisense; AATAACCGAGATTGTGCCTTTAGAT
>probe:Drosophila_2:1638290_at:504:315; Interrogation_Position=1686; Antisense; GCCTTTAGATCACACAGAGCTTTTG

Paste this into a BLAST search page for me
GACTTCGCCTGAGTGAAACCCGGATACAAGCGGCGCCAATTTTACATTTTGCCTAATTTATGTGCGTTCTCGAAAAGCGGTTAAAGCTTACTGATCCTAATGATCCTAACTCTCAAAACCACAACAACCACAACTAAATGCTGCGTCGCGTGCGTCGCGTATAATCAGCCCAAGGTATGTGTCGTACGTCTAACCACTGCCTGCTCCAGATTCAGATTGCTCGGAGGCGGCCAGTTGTTAACTTGTCTTATAACTTGTCTTACTCACGTGCCAGACGTGCCAGACGTTGTAGTTGTTACTAATAACCGAGATTGTGCCTTTAGATGCCTTTAGATCACACAGAGCTTTTG

Full Affymetrix probeset data:

Annotations for 1638290_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime