FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638292_at:

>probe:Drosophila_2:1638292_at:603:335; Interrogation_Position=263; Antisense; GCTACTTGGAGTGTAACTACCGACC
>probe:Drosophila_2:1638292_at:93:623; Interrogation_Position=299; Antisense; TGCCGCAGGTTACCGATCGGATTCG
>probe:Drosophila_2:1638292_at:92:289; Interrogation_Position=329; Antisense; CGGCCATTCGGGATGTGCTGGAACT
>probe:Drosophila_2:1638292_at:376:99; Interrogation_Position=386; Antisense; AGATGTCCGTGCAGATCCAGGAGCT
>probe:Drosophila_2:1638292_at:587:265; Interrogation_Position=423; Antisense; CAGTATTGATGCCTGCGCCGTAAAT
>probe:Drosophila_2:1638292_at:591:489; Interrogation_Position=442; Antisense; GTAAATTGCGCCTGCCTAGCCATGC
>probe:Drosophila_2:1638292_at:139:547; Interrogation_Position=472; Antisense; GGAGGCCTGCCTTTAAAGTATAGCT
>probe:Drosophila_2:1638292_at:665:217; Interrogation_Position=487; Antisense; AAGTATAGCTTTGCGGCTGTCCACG
>probe:Drosophila_2:1638292_at:119:431; Interrogation_Position=532; Antisense; GAGTATGTGCTAGATCCGGACCAAA
>probe:Drosophila_2:1638292_at:141:313; Interrogation_Position=577; Antisense; GCCAGTTTTACATTCGCCTTTGATT
>probe:Drosophila_2:1638292_at:216:467; Interrogation_Position=621; Antisense; GTTGATCCAGACAAAGGGCTCTTTC
>probe:Drosophila_2:1638292_at:433:21; Interrogation_Position=665; Antisense; ATATTGAGTGCCTATGCCTGGCTGC
>probe:Drosophila_2:1638292_at:692:627; Interrogation_Position=687; Antisense; TGCCAGTGCCGAGATCTTTCAGTTC
>probe:Drosophila_2:1638292_at:33:453; Interrogation_Position=699; Antisense; GATCTTTCAGTTCTATCGCAACCAG

Paste this into a BLAST search page for me
GCTACTTGGAGTGTAACTACCGACCTGCCGCAGGTTACCGATCGGATTCGCGGCCATTCGGGATGTGCTGGAACTAGATGTCCGTGCAGATCCAGGAGCTCAGTATTGATGCCTGCGCCGTAAATGTAAATTGCGCCTGCCTAGCCATGCGGAGGCCTGCCTTTAAAGTATAGCTAAGTATAGCTTTGCGGCTGTCCACGGAGTATGTGCTAGATCCGGACCAAAGCCAGTTTTACATTCGCCTTTGATTGTTGATCCAGACAAAGGGCTCTTTCATATTGAGTGCCTATGCCTGGCTGCTGCCAGTGCCGAGATCTTTCAGTTCGATCTTTCAGTTCTATCGCAACCAG

Full Affymetrix probeset data:

Annotations for 1638292_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720