Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638294_at:

>probe:Drosophila_2:1638294_at:537:439; Interrogation_Position=2620; Antisense; GAGGCCCATGCAGCTAGGCTATTTA
>probe:Drosophila_2:1638294_at:565:101; Interrogation_Position=2645; Antisense; AGACGCAGTCGGTGCAAGGTCCATT
>probe:Drosophila_2:1638294_at:456:223; Interrogation_Position=2660; Antisense; AAGGTCCATTGTCCCTGCAGCTGAA
>probe:Drosophila_2:1638294_at:595:365; Interrogation_Position=2682; Antisense; GAATCGCCTCTACAAGGTGCTTATT
>probe:Drosophila_2:1638294_at:208:541; Interrogation_Position=2712; Antisense; GGATATACTTAACCTCCTACCGATT
>probe:Drosophila_2:1638294_at:384:527; Interrogation_Position=2769; Antisense; GGGAACTCTGCAGCATCTGATCAGT
>probe:Drosophila_2:1638294_at:270:433; Interrogation_Position=2811; Antisense; GAGTGCCATTGTTCGCCTGTGCGAG
>probe:Drosophila_2:1638294_at:553:175; Interrogation_Position=2860; Antisense; AAACCATTGTTTGAGCGGATCTTGC
>probe:Drosophila_2:1638294_at:648:355; Interrogation_Position=2903; Antisense; GCACATTTGAGCTGGAGCCGCTAAT
>probe:Drosophila_2:1638294_at:557:709; Interrogation_Position=2942; Antisense; TTAAGATCAATCGTGCCAGGCAGTT
>probe:Drosophila_2:1638294_at:501:263; Interrogation_Position=2962; Antisense; CAGTTGTATGCTGCGGGTTTTCAAA
>probe:Drosophila_2:1638294_at:543:501; Interrogation_Position=3015; Antisense; GTCGCACTTAGTCCAATCCTTAGAG
>probe:Drosophila_2:1638294_at:330:235; Interrogation_Position=3029; Antisense; AATCCTTAGAGCACATGCCGCTTAG
>probe:Drosophila_2:1638294_at:532:55; Interrogation_Position=3094; Antisense; ATGAAAAAGCTCGACCACCTGGAAG

Paste this into a BLAST search page for me
GAGGCCCATGCAGCTAGGCTATTTAAGACGCAGTCGGTGCAAGGTCCATTAAGGTCCATTGTCCCTGCAGCTGAAGAATCGCCTCTACAAGGTGCTTATTGGATATACTTAACCTCCTACCGATTGGGAACTCTGCAGCATCTGATCAGTGAGTGCCATTGTTCGCCTGTGCGAGAAACCATTGTTTGAGCGGATCTTGCGCACATTTGAGCTGGAGCCGCTAATTTAAGATCAATCGTGCCAGGCAGTTCAGTTGTATGCTGCGGGTTTTCAAAGTCGCACTTAGTCCAATCCTTAGAGAATCCTTAGAGCACATGCCGCTTAGATGAAAAAGCTCGACCACCTGGAAG

Full Affymetrix probeset data:

Annotations for 1638294_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime