Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638296_at:

>probe:Drosophila_2:1638296_at:338:539; Interrogation_Position=1544; Antisense; GGTATATTCTCCAATTCCCATTACA
>probe:Drosophila_2:1638296_at:519:561; Interrogation_Position=1572; Antisense; GGAAGCAGTTCCAGTCCGCAGGAGC
>probe:Drosophila_2:1638296_at:697:503; Interrogation_Position=1585; Antisense; GTCCGCAGGAGCTTTGACTGGCGAT
>probe:Drosophila_2:1638296_at:250:141; Interrogation_Position=1601; Antisense; ACTGGCGATCGAGTTTGGCGTTTGC
>probe:Drosophila_2:1638296_at:259:75; Interrogation_Position=1693; Antisense; AGGACTGGCGAATTCCTGTTTGGCG
>probe:Drosophila_2:1638296_at:579:567; Interrogation_Position=1717; Antisense; GGCAGCGGTACTCCACGAATTGGTA
>probe:Drosophila_2:1638296_at:607:259; Interrogation_Position=1730; Antisense; CACGAATTGGTACCCTGTGTGGATT
>probe:Drosophila_2:1638296_at:703:595; Interrogation_Position=1747; Antisense; TGTGGATTGGGCTCATCTGGACACC
>probe:Drosophila_2:1638296_at:64:523; Interrogation_Position=1774; Antisense; GGGCACTGGACTGCTAACCAAGTAT
>probe:Drosophila_2:1638296_at:489:217; Interrogation_Position=1793; Antisense; AAGTATGGACTGGTACCCTATCTCA
>probe:Drosophila_2:1638296_at:340:171; Interrogation_Position=1822; Antisense; AAAGTACATGACAGGCAGGCCAACT
>probe:Drosophila_2:1638296_at:197:641; Interrogation_Position=1852; Antisense; TCTGGCGCAGTTTCTCTACCAAATG
>probe:Drosophila_2:1638296_at:350:581; Interrogation_Position=1880; Antisense; TGTCCCGCCAACCAAAAGTGAACTA
>probe:Drosophila_2:1638296_at:562:443; Interrogation_Position=2018; Antisense; GATGATGCCTGTGTCCAAAGTTGTC

Paste this into a BLAST search page for me
GGTATATTCTCCAATTCCCATTACAGGAAGCAGTTCCAGTCCGCAGGAGCGTCCGCAGGAGCTTTGACTGGCGATACTGGCGATCGAGTTTGGCGTTTGCAGGACTGGCGAATTCCTGTTTGGCGGGCAGCGGTACTCCACGAATTGGTACACGAATTGGTACCCTGTGTGGATTTGTGGATTGGGCTCATCTGGACACCGGGCACTGGACTGCTAACCAAGTATAAGTATGGACTGGTACCCTATCTCAAAAGTACATGACAGGCAGGCCAACTTCTGGCGCAGTTTCTCTACCAAATGTGTCCCGCCAACCAAAAGTGAACTAGATGATGCCTGTGTCCAAAGTTGTC

Full Affymetrix probeset data:

Annotations for 1638296_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime