FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638297_at:

>probe:Drosophila_2:1638297_at:705:481; Interrogation_Position=378; Antisense; GTATCCTTCATTTCCGGTGATTTTG
>probe:Drosophila_2:1638297_at:350:457; Interrogation_Position=396; Antisense; GATTTTGAGACGTACGATCCGGAAA
>probe:Drosophila_2:1638297_at:635:505; Interrogation_Position=422; Antisense; GGCCGACGATGTGTTAACCCTAAAG
>probe:Drosophila_2:1638297_at:702:407; Interrogation_Position=450; Antisense; GACGACCTGATTGGTTTGGCCGGAT
>probe:Drosophila_2:1638297_at:67:495; Interrogation_Position=516; Antisense; GTAATTGGGCGCTTCTACGATGAGA
>probe:Drosophila_2:1638297_at:403:271; Interrogation_Position=564; Antisense; CATAAGTTTCTGGAGCTGCTGGAGC
>probe:Drosophila_2:1638297_at:448:481; Interrogation_Position=632; Antisense; GTATCCCGGCTGCAATATCGAGTGG
>probe:Drosophila_2:1638297_at:154:225; Interrogation_Position=708; Antisense; AAGGAGCGCTCCTGGATCGGTTATC
>probe:Drosophila_2:1638297_at:283:541; Interrogation_Position=726; Antisense; GGTTATCCGCGCAAGCTGTACAGTC
>probe:Drosophila_2:1638297_at:148:153; Interrogation_Position=745; Antisense; ACAGTCGCGGCAACAAGAGTTTCCA
>probe:Drosophila_2:1638297_at:565:571; Interrogation_Position=824; Antisense; GGCTCACGGTGATGCCATGCTGAAA
>probe:Drosophila_2:1638297_at:86:53; Interrogation_Position=840; Antisense; ATGCTGAAACCCTACGACAATTGCG
>probe:Drosophila_2:1638297_at:269:137; Interrogation_Position=853; Antisense; ACGACAATTGCGAGCCACAGGCCAG
>probe:Drosophila_2:1638297_at:434:153; Interrogation_Position=869; Antisense; ACAGGCCAGGGAGTGCTTCTACAGG

Paste this into a BLAST search page for me
GTATCCTTCATTTCCGGTGATTTTGGATTTTGAGACGTACGATCCGGAAAGGCCGACGATGTGTTAACCCTAAAGGACGACCTGATTGGTTTGGCCGGATGTAATTGGGCGCTTCTACGATGAGACATAAGTTTCTGGAGCTGCTGGAGCGTATCCCGGCTGCAATATCGAGTGGAAGGAGCGCTCCTGGATCGGTTATCGGTTATCCGCGCAAGCTGTACAGTCACAGTCGCGGCAACAAGAGTTTCCAGGCTCACGGTGATGCCATGCTGAAAATGCTGAAACCCTACGACAATTGCGACGACAATTGCGAGCCACAGGCCAGACAGGCCAGGGAGTGCTTCTACAGG

Full Affymetrix probeset data:

Annotations for 1638297_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720