FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638298_at:

>probe:Drosophila_2:1638298_at:163:535; Interrogation_Position=1004; Antisense; GGTCCGCGACCAGGAATTACCAGTG
>probe:Drosophila_2:1638298_at:655:563; Interrogation_Position=1016; Antisense; GGAATTACCAGTGCCGCAGGCTAAT
>probe:Drosophila_2:1638298_at:453:345; Interrogation_Position=1031; Antisense; GCAGGCTAATGACAAACTTCCACAG
>probe:Drosophila_2:1638298_at:617:649; Interrogation_Position=1059; Antisense; TCAGCCGAGGCAGTGAGCAGCTACG
>probe:Drosophila_2:1638298_at:202:113; Interrogation_Position=1074; Antisense; AGCAGCTACGATAAGTTCTCGTCGA
>probe:Drosophila_2:1638298_at:156:473; Interrogation_Position=1088; Antisense; GTTCTCGTCGAAGTTCATTTCTATG
>probe:Drosophila_2:1638298_at:121:483; Interrogation_Position=1194; Antisense; GTATTTGATCGCTGTATTCTACTAT
>probe:Drosophila_2:1638298_at:39:207; Interrogation_Position=679; Antisense; AAGCTCTTGCCATGGACGAGTGCAT
>probe:Drosophila_2:1638298_at:588:295; Interrogation_Position=727; Antisense; CGCACAGCCGAGATTGCCAACGTTA
>probe:Drosophila_2:1638298_at:713:311; Interrogation_Position=742; Antisense; GCCAACGTTACTACATATGCGCCAA
>probe:Drosophila_2:1638298_at:197:13; Interrogation_Position=805; Antisense; ATTTTGACGTTGTACGGCGCTACTG
>probe:Drosophila_2:1638298_at:74:341; Interrogation_Position=823; Antisense; GCTACTGCGCTCTTGATCTGGGAAG
>probe:Drosophila_2:1638298_at:153:379; Interrogation_Position=844; Antisense; GAAGCGAATGCCAGGCTCTGCAGGC
>probe:Drosophila_2:1638298_at:176:237; Interrogation_Position=960; Antisense; AATCAGGGACACAAGCCGGTTCAGA

Paste this into a BLAST search page for me
GGTCCGCGACCAGGAATTACCAGTGGGAATTACCAGTGCCGCAGGCTAATGCAGGCTAATGACAAACTTCCACAGTCAGCCGAGGCAGTGAGCAGCTACGAGCAGCTACGATAAGTTCTCGTCGAGTTCTCGTCGAAGTTCATTTCTATGGTATTTGATCGCTGTATTCTACTATAAGCTCTTGCCATGGACGAGTGCATCGCACAGCCGAGATTGCCAACGTTAGCCAACGTTACTACATATGCGCCAAATTTTGACGTTGTACGGCGCTACTGGCTACTGCGCTCTTGATCTGGGAAGGAAGCGAATGCCAGGCTCTGCAGGCAATCAGGGACACAAGCCGGTTCAGA

Full Affymetrix probeset data:

Annotations for 1638298_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720