Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638299_at:

>probe:Drosophila_2:1638299_at:467:455; Interrogation_Position=4639; Antisense; GATACATATATTGTTCTTCCTTCGG
>probe:Drosophila_2:1638299_at:96:471; Interrogation_Position=4651; Antisense; GTTCTTCCTTCGGAATCAGTTTTGA
>probe:Drosophila_2:1638299_at:629:81; Interrogation_Position=4680; Antisense; AGGGACTACACCACAGTGAGGCTTT
>probe:Drosophila_2:1638299_at:723:153; Interrogation_Position=4692; Antisense; ACAGTGAGGCTTTGGATTTGGCCAA
>probe:Drosophila_2:1638299_at:465:457; Interrogation_Position=4719; Antisense; GATTTGTACATATTACCCCAATGGA
>probe:Drosophila_2:1638299_at:563:705; Interrogation_Position=4731; Antisense; TTACCCCAATGGAAAAGCGTGACAT
>probe:Drosophila_2:1638299_at:497:157; Interrogation_Position=4796; Antisense; ACACACCACTTATGTATAGGGACTA
>probe:Drosophila_2:1638299_at:164:423; Interrogation_Position=4848; Antisense; GAGAAGAACGAACTGCATCTGCATT
>probe:Drosophila_2:1638299_at:374:271; Interrogation_Position=4960; Antisense; CATATTTTAGCCATATTAACCCGGT
>probe:Drosophila_2:1638299_at:214:661; Interrogation_Position=4976; Antisense; TAACCCGGTAACTAGATGCATTCGT
>probe:Drosophila_2:1638299_at:491:445; Interrogation_Position=4990; Antisense; GATGCATTCGTGTACAAATATCTTA
>probe:Drosophila_2:1638299_at:140:703; Interrogation_Position=5012; Antisense; TTATCTTCTTCTCGGATTCATCCAA
>probe:Drosophila_2:1638299_at:60:463; Interrogation_Position=5026; Antisense; GATTCATCCAAGGAGCATACGCATA
>probe:Drosophila_2:1638299_at:701:105; Interrogation_Position=5175; Antisense; AGCTTTATTTACACGCTTGAACAAT

Paste this into a BLAST search page for me
GATACATATATTGTTCTTCCTTCGGGTTCTTCCTTCGGAATCAGTTTTGAAGGGACTACACCACAGTGAGGCTTTACAGTGAGGCTTTGGATTTGGCCAAGATTTGTACATATTACCCCAATGGATTACCCCAATGGAAAAGCGTGACATACACACCACTTATGTATAGGGACTAGAGAAGAACGAACTGCATCTGCATTCATATTTTAGCCATATTAACCCGGTTAACCCGGTAACTAGATGCATTCGTGATGCATTCGTGTACAAATATCTTATTATCTTCTTCTCGGATTCATCCAAGATTCATCCAAGGAGCATACGCATAAGCTTTATTTACACGCTTGAACAAT

Full Affymetrix probeset data:

Annotations for 1638299_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime