FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638301_at:

>probe:Drosophila_2:1638301_at:200:19; Interrogation_Position=114; Antisense; ATTTGGTGGTCAACAAGGCGGCTTT
>probe:Drosophila_2:1638301_at:62:559; Interrogation_Position=316; Antisense; GGACAAGGCGGCTTTGGCGAACACC
>probe:Drosophila_2:1638301_at:591:277; Interrogation_Position=327; Antisense; CTTTGGCGAACACCACAGACACCAT
>probe:Drosophila_2:1638301_at:703:65; Interrogation_Position=350; Antisense; ATGGAGGACATCATGGGCGCTTCTA
>probe:Drosophila_2:1638301_at:236:63; Interrogation_Position=362; Antisense; ATGGGCGCTTCTAATACCCCAATTT
>probe:Drosophila_2:1638301_at:408:651; Interrogation_Position=373; Antisense; TAATACCCCAATTTCTTAATCGTCT
>probe:Drosophila_2:1638301_at:76:147; Interrogation_Position=39; Antisense; ACTACTGATTGTTGTTCTTGCCCTG
>probe:Drosophila_2:1638301_at:314:477; Interrogation_Position=423; Antisense; GTTTTTTCCAACATATACCTGCTGT
>probe:Drosophila_2:1638301_at:29:29; Interrogation_Position=437; Antisense; ATACCTGCTGTTTTCGTGAACCAAA
>probe:Drosophila_2:1638301_at:187:465; Interrogation_Position=45; Antisense; GATTGTTGTTCTTGCCCTGGTGGCC
>probe:Drosophila_2:1638301_at:378:687; Interrogation_Position=462; Antisense; TATTAAGGAGACCACGGATCCTGGA
>probe:Drosophila_2:1638301_at:322:545; Interrogation_Position=477; Antisense; GGATCCTGGAGATAACTCGCAAACG
>probe:Drosophila_2:1638301_at:504:347; Interrogation_Position=70; Antisense; GCAGTTTTGGCCAGACCTCAATTTG
>probe:Drosophila_2:1638301_at:678:263; Interrogation_Position=81; Antisense; CAGACCTCAATTTGGACCTGGTGGT

Paste this into a BLAST search page for me
ATTTGGTGGTCAACAAGGCGGCTTTGGACAAGGCGGCTTTGGCGAACACCCTTTGGCGAACACCACAGACACCATATGGAGGACATCATGGGCGCTTCTAATGGGCGCTTCTAATACCCCAATTTTAATACCCCAATTTCTTAATCGTCTACTACTGATTGTTGTTCTTGCCCTGGTTTTTTCCAACATATACCTGCTGTATACCTGCTGTTTTCGTGAACCAAAGATTGTTGTTCTTGCCCTGGTGGCCTATTAAGGAGACCACGGATCCTGGAGGATCCTGGAGATAACTCGCAAACGGCAGTTTTGGCCAGACCTCAATTTGCAGACCTCAATTTGGACCTGGTGGT

Full Affymetrix probeset data:

Annotations for 1638301_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720