FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638303_at:

>probe:Drosophila_2:1638303_at:50:473; Interrogation_Position=199; Antisense; GTTAAGCCGCGTTGGGTTATCACCG
>probe:Drosophila_2:1638303_at:110:97; Interrogation_Position=263; Antisense; AGATCTATGGTGGTGCCTCCAATCA
>probe:Drosophila_2:1638303_at:245:405; Interrogation_Position=319; Antisense; GACTACATTGCGATTCGTCCGGATT
>probe:Drosophila_2:1638303_at:230:103; Interrogation_Position=353; Antisense; AGACCCTCAATATGGATGTGGCTGC
>probe:Drosophila_2:1638303_at:83:65; Interrogation_Position=368; Antisense; ATGTGGCTGCCTTGCGCTTGAATTC
>probe:Drosophila_2:1638303_at:137:687; Interrogation_Position=411; Antisense; TATAGAGACCATACCTCTGGCGGCA
>probe:Drosophila_2:1638303_at:296:119; Interrogation_Position=447; Antisense; AGCTCGCGCTTTGGTCAAGGTATCT
>probe:Drosophila_2:1638303_at:8:541; Interrogation_Position=478; Antisense; GGTTTCCTAACTGCCGATGCGACAA
>probe:Drosophila_2:1638303_at:232:173; Interrogation_Position=501; Antisense; AAAGACTGCCGAGCGGGTGCACAGT
>probe:Drosophila_2:1638303_at:525:631; Interrogation_Position=553; Antisense; TCCTGCGTGTCTGCTTTCAGAGGAA
>probe:Drosophila_2:1638303_at:103:373; Interrogation_Position=624; Antisense; GAAGGATTCCTGTGACGGCGACTCG
>probe:Drosophila_2:1638303_at:34:521; Interrogation_Position=650; Antisense; GTGGACCTTTGGTGTATCGCGGCCA
>probe:Drosophila_2:1638303_at:139:31; Interrogation_Position=729; Antisense; ATACACCAGTGTGCCTGAGATCCGG
>probe:Drosophila_2:1638303_at:67:99; Interrogation_Position=746; Antisense; AGATCCGGGATTGGTTTCAGCGCGT

Paste this into a BLAST search page for me
GTTAAGCCGCGTTGGGTTATCACCGAGATCTATGGTGGTGCCTCCAATCAGACTACATTGCGATTCGTCCGGATTAGACCCTCAATATGGATGTGGCTGCATGTGGCTGCCTTGCGCTTGAATTCTATAGAGACCATACCTCTGGCGGCAAGCTCGCGCTTTGGTCAAGGTATCTGGTTTCCTAACTGCCGATGCGACAAAAAGACTGCCGAGCGGGTGCACAGTTCCTGCGTGTCTGCTTTCAGAGGAAGAAGGATTCCTGTGACGGCGACTCGGTGGACCTTTGGTGTATCGCGGCCAATACACCAGTGTGCCTGAGATCCGGAGATCCGGGATTGGTTTCAGCGCGT

Full Affymetrix probeset data:

Annotations for 1638303_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720