Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638305_at:

>probe:Drosophila_2:1638305_at:80:63; Interrogation_Position=1016; Antisense; ATGGGTTTCCGTTCTTAGTGTCCAT
>probe:Drosophila_2:1638305_at:199:61; Interrogation_Position=1039; Antisense; ATGTCGCACTAGGTTGTCCGGAGTT
>probe:Drosophila_2:1638305_at:689:535; Interrogation_Position=1070; Antisense; GGTCCCGTGCCACTGAAAGTCAATT
>probe:Drosophila_2:1638305_at:688:387; Interrogation_Position=1097; Antisense; GAAAATGTATGAAAGCGCTCGCCAG
>probe:Drosophila_2:1638305_at:436:545; Interrogation_Position=1127; Antisense; GGATCCTGATGACCGGCGATCCGTA
>probe:Drosophila_2:1638305_at:286:317; Interrogation_Position=1157; Antisense; GCCTCGATCATCCAGTATTATACGC
>probe:Drosophila_2:1638305_at:171:23; Interrogation_Position=1193; Antisense; ATATGTCGGTATGTCTAGTCAACTA
>probe:Drosophila_2:1638305_at:143:683; Interrogation_Position=1216; Antisense; TATGTATCTACTCTAGCACCTAGTC
>probe:Drosophila_2:1638305_at:140:355; Interrogation_Position=1231; Antisense; GCACCTAGTCTCCACGTATACAAGA
>probe:Drosophila_2:1638305_at:553:199; Interrogation_Position=858; Antisense; AACGCGACCAGTGGCAGAAGCTCCA
>probe:Drosophila_2:1638305_at:627:469; Interrogation_Position=907; Antisense; GTTGCCCAGCAACTAATCTCGCAGA
>probe:Drosophila_2:1638305_at:194:37; Interrogation_Position=922; Antisense; ATCTCGCAGAGAATCGCCGTAGCAC
>probe:Drosophila_2:1638305_at:55:155; Interrogation_Position=966; Antisense; AACTAATCCACCTGTATCTAACCGT
>probe:Drosophila_2:1638305_at:505:21; Interrogation_Position=991; Antisense; ATATAGCATGTGTGTTTCCTCCGCG

Paste this into a BLAST search page for me
ATGGGTTTCCGTTCTTAGTGTCCATATGTCGCACTAGGTTGTCCGGAGTTGGTCCCGTGCCACTGAAAGTCAATTGAAAATGTATGAAAGCGCTCGCCAGGGATCCTGATGACCGGCGATCCGTAGCCTCGATCATCCAGTATTATACGCATATGTCGGTATGTCTAGTCAACTATATGTATCTACTCTAGCACCTAGTCGCACCTAGTCTCCACGTATACAAGAAACGCGACCAGTGGCAGAAGCTCCAGTTGCCCAGCAACTAATCTCGCAGAATCTCGCAGAGAATCGCCGTAGCACAACTAATCCACCTGTATCTAACCGTATATAGCATGTGTGTTTCCTCCGCG

Full Affymetrix probeset data:

Annotations for 1638305_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime