FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638306_at:

>probe:Drosophila_2:1638306_at:564:341; Interrogation_Position=2136; Antisense; GCTATAGAGGCTTATCGGACTGCAA
>probe:Drosophila_2:1638306_at:431:481; Interrogation_Position=2164; Antisense; GTATTAGTGCGGCTAGAGCAACGAC
>probe:Drosophila_2:1638306_at:660:677; Interrogation_Position=2177; Antisense; TAGAGCAACGACAGCCCGGGAGAAT
>probe:Drosophila_2:1638306_at:275:303; Interrogation_Position=2192; Antisense; CCGGGAGAATCTCAGCAAGCTCTTA
>probe:Drosophila_2:1638306_at:630:111; Interrogation_Position=2205; Antisense; AGCAAGCTCTTAAAACGCCTGGAAA
>probe:Drosophila_2:1638306_at:507:427; Interrogation_Position=2249; Antisense; GAGATAAGCGTTTCAAGTCCCACCA
>probe:Drosophila_2:1638306_at:648:695; Interrogation_Position=2259; Antisense; TTTCAAGTCCCACCATCCAAATATG
>probe:Drosophila_2:1638306_at:725:81; Interrogation_Position=2319; Antisense; AGAGGTATGTACACTTCGCAAGCTG
>probe:Drosophila_2:1638306_at:395:359; Interrogation_Position=2336; Antisense; GCAAGCTGTAATAATCCCAAACGAA
>probe:Drosophila_2:1638306_at:4:37; Interrogation_Position=2453; Antisense; ATCATACATTCATATCCCATCAGCT
>probe:Drosophila_2:1638306_at:727:115; Interrogation_Position=2474; Antisense; AGCTAAAATCTCATGACACCCTAAT
>probe:Drosophila_2:1638306_at:158:679; Interrogation_Position=2520; Antisense; TAGTTTATTCATTTACTCGAGGGTA
>probe:Drosophila_2:1638306_at:121:177; Interrogation_Position=2610; Antisense; AAACTCTAGAACTAAGCGCTACATG
>probe:Drosophila_2:1638306_at:258:365; Interrogation_Position=2647; Antisense; GAATAGTGACAATTGTGGCACCATT

Paste this into a BLAST search page for me
GCTATAGAGGCTTATCGGACTGCAAGTATTAGTGCGGCTAGAGCAACGACTAGAGCAACGACAGCCCGGGAGAATCCGGGAGAATCTCAGCAAGCTCTTAAGCAAGCTCTTAAAACGCCTGGAAAGAGATAAGCGTTTCAAGTCCCACCATTTCAAGTCCCACCATCCAAATATGAGAGGTATGTACACTTCGCAAGCTGGCAAGCTGTAATAATCCCAAACGAAATCATACATTCATATCCCATCAGCTAGCTAAAATCTCATGACACCCTAATTAGTTTATTCATTTACTCGAGGGTAAAACTCTAGAACTAAGCGCTACATGGAATAGTGACAATTGTGGCACCATT

Full Affymetrix probeset data:

Annotations for 1638306_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720