Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638308_s_at:

>probe:Drosophila_2:1638308_s_at:680:559; Interrogation_Position=145; Antisense; GGAACCGTGGCCTTGCGTGAAATTC
>probe:Drosophila_2:1638308_s_at:316:289; Interrogation_Position=160; Antisense; CGTGAAATTCGTCGCTACCAAAAGA
>probe:Drosophila_2:1638308_s_at:485:171; Interrogation_Position=180; Antisense; AAAGAGCACCGAGCTTCTAATCCGC
>probe:Drosophila_2:1638308_s_at:145:713; Interrogation_Position=194; Antisense; TTCTAATCCGCAAGCTGCCTTTCCA
>probe:Drosophila_2:1638308_s_at:353:165; Interrogation_Position=233; Antisense; AAATCGCTCAGGACTTTAAGACGGA
>probe:Drosophila_2:1638308_s_at:565:645; Interrogation_Position=249; Antisense; TAAGACGGACTTGCGATTCCAGAGC
>probe:Drosophila_2:1638308_s_at:466:721; Interrogation_Position=259; Antisense; TTGCGATTCCAGAGCTCGGCGGTTA
>probe:Drosophila_2:1638308_s_at:551:281; Interrogation_Position=273; Antisense; CTCGGCGGTTATGGCTCTGCAGGAA
>probe:Drosophila_2:1638308_s_at:404:367; Interrogation_Position=295; Antisense; GAAGCTAGCGAAGCCTACCTGGTTG
>probe:Drosophila_2:1638308_s_at:423:665; Interrogation_Position=310; Antisense; TACCTGGTTGGTCTCTTCGAAGATA
>probe:Drosophila_2:1638308_s_at:472:457; Interrogation_Position=331; Antisense; GATACCAACTTGTGTGCCATTCATG
>probe:Drosophila_2:1638308_s_at:216:207; Interrogation_Position=358; Antisense; AAGCGTGTCACCATAATGCCCAAAG
>probe:Drosophila_2:1638308_s_at:347:625; Interrogation_Position=374; Antisense; TGCCCAAAGACATCCAGTTAGCGCG
>probe:Drosophila_2:1638308_s_at:461:707; Interrogation_Position=391; Antisense; TTAGCGCGACGCATTCGCGGCGAGC

Paste this into a BLAST search page for me
GGAACCGTGGCCTTGCGTGAAATTCCGTGAAATTCGTCGCTACCAAAAGAAAAGAGCACCGAGCTTCTAATCCGCTTCTAATCCGCAAGCTGCCTTTCCAAAATCGCTCAGGACTTTAAGACGGATAAGACGGACTTGCGATTCCAGAGCTTGCGATTCCAGAGCTCGGCGGTTACTCGGCGGTTATGGCTCTGCAGGAAGAAGCTAGCGAAGCCTACCTGGTTGTACCTGGTTGGTCTCTTCGAAGATAGATACCAACTTGTGTGCCATTCATGAAGCGTGTCACCATAATGCCCAAAGTGCCCAAAGACATCCAGTTAGCGCGTTAGCGCGACGCATTCGCGGCGAGC

Full Affymetrix probeset data:

Annotations for 1638308_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime