FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638309_at:

>probe:Drosophila_2:1638309_at:694:131; Interrogation_Position=382; Antisense; ACCGTGGATCTGGTTCGCAATCTGC
>probe:Drosophila_2:1638309_at:60:513; Interrogation_Position=484; Antisense; GTGTATACTGCTCGAAATCCCAAGG
>probe:Drosophila_2:1638309_at:72:165; Interrogation_Position=498; Antisense; AAATCCCAAGGATCTTTGCGTCTCG
>probe:Drosophila_2:1638309_at:371:693; Interrogation_Position=512; Antisense; TTTGCGTCTCGTACTATCACTACTT
>probe:Drosophila_2:1638309_at:84:147; Interrogation_Position=530; Antisense; ACTACTTCAAGTTGCTGCACGGCAT
>probe:Drosophila_2:1638309_at:143:111; Interrogation_Position=569; Antisense; AGCAATTCGTGGATCTCTTCCTGGA
>probe:Drosophila_2:1638309_at:233:441; Interrogation_Position=606; Antisense; GATGGGATCCTATTGGCGGCACGTC
>probe:Drosophila_2:1638309_at:247:307; Interrogation_Position=629; Antisense; TCCTGCCCTTTTGGAAACGTAGCCA
>probe:Drosophila_2:1638309_at:86:223; Interrogation_Position=694; Antisense; AAGGATCTGCCCAGTGTAGTTCGCC
>probe:Drosophila_2:1638309_at:490:95; Interrogation_Position=727; Antisense; AGATTCCTGGGCGTTCAAAGTCTCC
>probe:Drosophila_2:1638309_at:412:219; Interrogation_Position=744; Antisense; AAGTCTCCTCGATGTGAGCACTTTG
>probe:Drosophila_2:1638309_at:106:455; Interrogation_Position=781; Antisense; GATCACCTCACATTCGACAAGATGC
>probe:Drosophila_2:1638309_at:131:367; Interrogation_Position=844; Antisense; GAATCATCTTCCAAGTTCATACGCA
>probe:Drosophila_2:1638309_at:339:401; Interrogation_Position=941; Antisense; GACATATGCGTGGTTCTGGATTAAA

Paste this into a BLAST search page for me
ACCGTGGATCTGGTTCGCAATCTGCGTGTATACTGCTCGAAATCCCAAGGAAATCCCAAGGATCTTTGCGTCTCGTTTGCGTCTCGTACTATCACTACTTACTACTTCAAGTTGCTGCACGGCATAGCAATTCGTGGATCTCTTCCTGGAGATGGGATCCTATTGGCGGCACGTCTCCTGCCCTTTTGGAAACGTAGCCAAAGGATCTGCCCAGTGTAGTTCGCCAGATTCCTGGGCGTTCAAAGTCTCCAAGTCTCCTCGATGTGAGCACTTTGGATCACCTCACATTCGACAAGATGCGAATCATCTTCCAAGTTCATACGCAGACATATGCGTGGTTCTGGATTAAA

Full Affymetrix probeset data:

Annotations for 1638309_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720