Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638310_at:

>probe:Drosophila_2:1638310_at:327:323; Interrogation_Position=1547; Antisense; GCGCGCCATCAAGGTACAGAGTCAT
>probe:Drosophila_2:1638310_at:279:101; Interrogation_Position=1564; Antisense; AGAGTCATCTCTCTGACATGCCCGA
>probe:Drosophila_2:1638310_at:355:401; Interrogation_Position=1578; Antisense; GACATGCCCGAGTACATAGTGCCAA
>probe:Drosophila_2:1638310_at:391:309; Interrogation_Position=1598; Antisense; GCCAAAGGCCCTGAAGCGAGTGGTT
>probe:Drosophila_2:1638310_at:462:121; Interrogation_Position=1612; Antisense; AGCGAGTGGTTGGAACGTCCTCTTC
>probe:Drosophila_2:1638310_at:272:501; Interrogation_Position=1641; Antisense; GTCGGAGCCTCGGAAGCCAAACAGC
>probe:Drosophila_2:1638310_at:556:635; Interrogation_Position=1693; Antisense; TCGAGCGGCAGGTCAATGATCCTCT
>probe:Drosophila_2:1638310_at:203:59; Interrogation_Position=1708; Antisense; ATGATCCTCTGATGGCTAGCCAGGT
>probe:Drosophila_2:1638310_at:305:277; Interrogation_Position=1723; Antisense; CTAGCCAGGTGGACTTCGGGAAACG
>probe:Drosophila_2:1638310_at:685:327; Interrogation_Position=1748; Antisense; GCGTCCTGCCCACCGGAGAAAAAAG
>probe:Drosophila_2:1638310_at:701:537; Interrogation_Position=1795; Antisense; GGTATCTATAGTCGCATTAGTCAAT
>probe:Drosophila_2:1638310_at:274:323; Interrogation_Position=1863; Antisense; GCGGCCGTTGAAGATGTTTGGAATT
>probe:Drosophila_2:1638310_at:280:91; Interrogation_Position=1954; Antisense; AGATAGCTGCAGATTGACAAACCCA
>probe:Drosophila_2:1638310_at:307:687; Interrogation_Position=2101; Antisense; TATATTTATTTGCATGCCCGCCAAA

Paste this into a BLAST search page for me
GCGCGCCATCAAGGTACAGAGTCATAGAGTCATCTCTCTGACATGCCCGAGACATGCCCGAGTACATAGTGCCAAGCCAAAGGCCCTGAAGCGAGTGGTTAGCGAGTGGTTGGAACGTCCTCTTCGTCGGAGCCTCGGAAGCCAAACAGCTCGAGCGGCAGGTCAATGATCCTCTATGATCCTCTGATGGCTAGCCAGGTCTAGCCAGGTGGACTTCGGGAAACGGCGTCCTGCCCACCGGAGAAAAAAGGGTATCTATAGTCGCATTAGTCAATGCGGCCGTTGAAGATGTTTGGAATTAGATAGCTGCAGATTGACAAACCCATATATTTATTTGCATGCCCGCCAAA

Full Affymetrix probeset data:

Annotations for 1638310_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime