FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638311_at:

>probe:Drosophila_2:1638311_at:191:327; Interrogation_Position=1050; Antisense; GCGATATCTCAAGTTATCACCTGTA
>probe:Drosophila_2:1638311_at:550:163; Interrogation_Position=532; Antisense; AAATTTCTGCTGATTGCCGACGACA
>probe:Drosophila_2:1638311_at:96:397; Interrogation_Position=553; Antisense; GACAATAACGATGGCCTGCTGCATT
>probe:Drosophila_2:1638311_at:636:343; Interrogation_Position=573; Antisense; GCATTACCCGGAATTCGTGAAGGCA
>probe:Drosophila_2:1638311_at:368:95; Interrogation_Position=657; Antisense; AGATCCCGACTAACAGTACTCAACC
>probe:Drosophila_2:1638311_at:505:641; Interrogation_Position=740; Antisense; TCTGATTTCCAAGCTGAACCATTTG
>probe:Drosophila_2:1638311_at:668:377; Interrogation_Position=755; Antisense; GAACCATTTGAGACTGTAATACCGC
>probe:Drosophila_2:1638311_at:138:407; Interrogation_Position=803; Antisense; GACTGCACCCCGTTTGTAATACAAC
>probe:Drosophila_2:1638311_at:202:433; Interrogation_Position=867; Antisense; GAGTGCATTTTGCTTTGGAATCTTT
>probe:Drosophila_2:1638311_at:409:209; Interrogation_Position=893; Antisense; AAGCAATCCGTCACAGGTCTGGGTC
>probe:Drosophila_2:1638311_at:537:499; Interrogation_Position=909; Antisense; GTCTGGGTCGTGTTGCAGGCCACTC
>probe:Drosophila_2:1638311_at:541:337; Interrogation_Position=954; Antisense; GCTCGCTCCATCAGGACGATGAGGT
>probe:Drosophila_2:1638311_at:183:57; Interrogation_Position=972; Antisense; ATGAGGTCGTTGTAGCGCGGCTTCT
>probe:Drosophila_2:1638311_at:296:309; Interrogation_Position=997; Antisense; CCAGCGGCACTCTGTGGATTAGTTA

Paste this into a BLAST search page for me
GCGATATCTCAAGTTATCACCTGTAAAATTTCTGCTGATTGCCGACGACAGACAATAACGATGGCCTGCTGCATTGCATTACCCGGAATTCGTGAAGGCAAGATCCCGACTAACAGTACTCAACCTCTGATTTCCAAGCTGAACCATTTGGAACCATTTGAGACTGTAATACCGCGACTGCACCCCGTTTGTAATACAACGAGTGCATTTTGCTTTGGAATCTTTAAGCAATCCGTCACAGGTCTGGGTCGTCTGGGTCGTGTTGCAGGCCACTCGCTCGCTCCATCAGGACGATGAGGTATGAGGTCGTTGTAGCGCGGCTTCTCCAGCGGCACTCTGTGGATTAGTTA

Full Affymetrix probeset data:

Annotations for 1638311_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720