FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638312_at:

>probe:Drosophila_2:1638312_at:660:581; Interrogation_Position=1297; Antisense; TGGCGGTGACCTTTGCCAACCTGAT
>probe:Drosophila_2:1638312_at:313:27; Interrogation_Position=1328; Antisense; ATACGCCTTGTCTTTTGCGGCCGGA
>probe:Drosophila_2:1638312_at:196:331; Interrogation_Position=1344; Antisense; GCGGCCGGAGCCATGATATACATTG
>probe:Drosophila_2:1638312_at:641:555; Interrogation_Position=1373; Antisense; GGACGACATTCTGCCGGAGGCTCAT
>probe:Drosophila_2:1638312_at:16:143; Interrogation_Position=1431; Antisense; ACTGTATCCGGCTTCCTGATCATGA
>probe:Drosophila_2:1638312_at:692:637; Interrogation_Position=1476; Antisense; TCGTGAGGAACGAACGGCTCGCCTT
>probe:Drosophila_2:1638312_at:413:95; Interrogation_Position=1541; Antisense; AGATTCCACTGTACTTAACGCAAAA
>probe:Drosophila_2:1638312_at:157:601; Interrogation_Position=1596; Antisense; TGTACAAATCTCAGAACCAGCCCTA
>probe:Drosophila_2:1638312_at:555:377; Interrogation_Position=1666; Antisense; GAAGCTTGACAACCAGCGATGCCGC
>probe:Drosophila_2:1638312_at:31:327; Interrogation_Position=1689; Antisense; GCGACGACATCCGTGCAATTGTGTA
>probe:Drosophila_2:1638312_at:342:597; Interrogation_Position=1716; Antisense; TGTGCACACGTATCTGTACAGCATT
>probe:Drosophila_2:1638312_at:109:491; Interrogation_Position=1731; Antisense; GTACAGCATTCCCAGCGAGTTATGT
>probe:Drosophila_2:1638312_at:219:695; Interrogation_Position=1806; Antisense; TTTTAAGTTGTCACCGGCGTCCAGT
>probe:Drosophila_2:1638312_at:425:291; Interrogation_Position=1823; Antisense; CGTCCAGTAGCTTGTGTCTTTTTTA

Paste this into a BLAST search page for me
TGGCGGTGACCTTTGCCAACCTGATATACGCCTTGTCTTTTGCGGCCGGAGCGGCCGGAGCCATGATATACATTGGGACGACATTCTGCCGGAGGCTCATACTGTATCCGGCTTCCTGATCATGATCGTGAGGAACGAACGGCTCGCCTTAGATTCCACTGTACTTAACGCAAAATGTACAAATCTCAGAACCAGCCCTAGAAGCTTGACAACCAGCGATGCCGCGCGACGACATCCGTGCAATTGTGTATGTGCACACGTATCTGTACAGCATTGTACAGCATTCCCAGCGAGTTATGTTTTTAAGTTGTCACCGGCGTCCAGTCGTCCAGTAGCTTGTGTCTTTTTTA

Full Affymetrix probeset data:

Annotations for 1638312_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720