FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638313_at:

>probe:Drosophila_2:1638313_at:158:151; Interrogation_Position=1052; Antisense; ACATTTCACTGTTGATTGGAGGCCA
>probe:Drosophila_2:1638313_at:421:571; Interrogation_Position=1092; Antisense; GGCTAGCATATTTATACCTTGTGAA
>probe:Drosophila_2:1638313_at:475:509; Interrogation_Position=1112; Antisense; GTGAAAAGTACACTATCGCCTGGCC
>probe:Drosophila_2:1638313_at:89:685; Interrogation_Position=1125; Antisense; TATCGCCTGGCCTAAAAATCTCAAG
>probe:Drosophila_2:1638313_at:420:679; Interrogation_Position=627; Antisense; TAGTGGCAGCTTTCGCGTACGGAAT
>probe:Drosophila_2:1638313_at:476:367; Interrogation_Position=648; Antisense; GAATCGTGTACTTGGACAGCGCGGT
>probe:Drosophila_2:1638313_at:476:109; Interrogation_Position=732; Antisense; AGAAGACTGCCTCGATGCACTTGGG
>probe:Drosophila_2:1638313_at:75:603; Interrogation_Position=771; Antisense; TGTTCTGCGGATTTCTGGTCACGGT
>probe:Drosophila_2:1638313_at:686:589; Interrogation_Position=786; Antisense; TGGTCACGGTCTTCATGTACTTCGA
>probe:Drosophila_2:1638313_at:37:61; Interrogation_Position=800; Antisense; ATGTACTTCGACTTGTACTCGTAGA
>probe:Drosophila_2:1638313_at:351:613; Interrogation_Position=827; Antisense; TGAATACCCATTTCCTTCCAATTAG
>probe:Drosophila_2:1638313_at:549:667; Interrogation_Position=869; Antisense; TATTAGACTTTATACGCCCACTTCG
>probe:Drosophila_2:1638313_at:326:133; Interrogation_Position=882; Antisense; ACGCCCACTTCGGAATTTGTATTTG
>probe:Drosophila_2:1638313_at:634:503; Interrogation_Position=912; Antisense; GTCCTTGAAACTGTGCAATGCTCCT

Paste this into a BLAST search page for me
ACATTTCACTGTTGATTGGAGGCCAGGCTAGCATATTTATACCTTGTGAAGTGAAAAGTACACTATCGCCTGGCCTATCGCCTGGCCTAAAAATCTCAAGTAGTGGCAGCTTTCGCGTACGGAATGAATCGTGTACTTGGACAGCGCGGTAGAAGACTGCCTCGATGCACTTGGGTGTTCTGCGGATTTCTGGTCACGGTTGGTCACGGTCTTCATGTACTTCGAATGTACTTCGACTTGTACTCGTAGATGAATACCCATTTCCTTCCAATTAGTATTAGACTTTATACGCCCACTTCGACGCCCACTTCGGAATTTGTATTTGGTCCTTGAAACTGTGCAATGCTCCT

Full Affymetrix probeset data:

Annotations for 1638313_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720