FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638314_at:

>probe:Drosophila_2:1638314_at:190:329; Interrogation_Position=116; Antisense; GCGTCACCTTCTCTTTGGAGCTGTA
>probe:Drosophila_2:1638314_at:708:129; Interrogation_Position=121; Antisense; ACCTTCTCTTTGGAGCTGTATCACA
>probe:Drosophila_2:1638314_at:190:335; Interrogation_Position=135; Antisense; GCTGTATCACAAGAATATCATCAAG
>probe:Drosophila_2:1638314_at:635:603; Interrogation_Position=14; Antisense; TGCTTAGGCACAAACGCAACTGCCA
>probe:Drosophila_2:1638314_at:454:209; Interrogation_Position=157; Antisense; AAGAAACTGCCCAGTCTTGGCCAAT
>probe:Drosophila_2:1638314_at:5:307; Interrogation_Position=167; Antisense; CCAGTCTTGGCCAATTTCACGTTTA
>probe:Drosophila_2:1638314_at:77:643; Interrogation_Position=171; Antisense; TCTTGGCCAATTTCACGTTTACCGG
>probe:Drosophila_2:1638314_at:330:577; Interrogation_Position=175; Antisense; GGCCAATTTCACGTTTACCGGCTGA
>probe:Drosophila_2:1638314_at:618:17; Interrogation_Position=180; Antisense; ATTTCACGTTTACCGGCTGACCAAG
>probe:Drosophila_2:1638314_at:105:697; Interrogation_Position=188; Antisense; TTTACCGGCTGACCAAGAACGTCTG
>probe:Drosophila_2:1638314_at:674:609; Interrogation_Position=197; Antisense; TGACCAAGAACGTCTGCCAGACTTA
>probe:Drosophila_2:1638314_at:376:307; Interrogation_Position=53; Antisense; CCAGCGACGCCGAGCATGTGAAGTT
>probe:Drosophila_2:1638314_at:413:409; Interrogation_Position=58; Antisense; GACGCCGAGCATGTGAAGTTAAAGC
>probe:Drosophila_2:1638314_at:620:215; Interrogation_Position=73; Antisense; AAGTTAAAGCCGCATTTTCATCCGC

Paste this into a BLAST search page for me
GCGTCACCTTCTCTTTGGAGCTGTAACCTTCTCTTTGGAGCTGTATCACAGCTGTATCACAAGAATATCATCAAGTGCTTAGGCACAAACGCAACTGCCAAAGAAACTGCCCAGTCTTGGCCAATCCAGTCTTGGCCAATTTCACGTTTATCTTGGCCAATTTCACGTTTACCGGGGCCAATTTCACGTTTACCGGCTGAATTTCACGTTTACCGGCTGACCAAGTTTACCGGCTGACCAAGAACGTCTGTGACCAAGAACGTCTGCCAGACTTACCAGCGACGCCGAGCATGTGAAGTTGACGCCGAGCATGTGAAGTTAAAGCAAGTTAAAGCCGCATTTTCATCCGC

Full Affymetrix probeset data:

Annotations for 1638314_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720