Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638315_s_at:

>probe:Drosophila_2:1638315_s_at:112:299; Interrogation_Position=1001; Antisense; CGCCCACAGCCGAGTAGTTTTTAAG
>probe:Drosophila_2:1638315_s_at:580:581; Interrogation_Position=1120; Antisense; TGGGTTTAGTTTTCCTTGCCGAATG
>probe:Drosophila_2:1638315_s_at:220:247; Interrogation_Position=1178; Antisense; AATTGAGGCGGTGAGTCGGCATATT
>probe:Drosophila_2:1638315_s_at:565:157; Interrogation_Position=1241; Antisense; ACAAAACGCGTTGGCTTCGAATTCA
>probe:Drosophila_2:1638315_s_at:580:103; Interrogation_Position=675; Antisense; AGACCTTCTATCACTTCGATTCGTA
>probe:Drosophila_2:1638315_s_at:673:525; Interrogation_Position=715; Antisense; GGGCAACTCCCTGGAGCTGATGAAC
>probe:Drosophila_2:1638315_s_at:488:31; Interrogation_Position=743; Antisense; ATCAAGGACCTGCTTGGCGTCCGAA
>probe:Drosophila_2:1638315_s_at:267:71; Interrogation_Position=801; Antisense; AGGCGAACGGCTACGACTGTGGCAT
>probe:Drosophila_2:1638315_s_at:75:407; Interrogation_Position=815; Antisense; GACTGTGGCATCCATGTTATCTGCA
>probe:Drosophila_2:1638315_s_at:506:475; Interrogation_Position=830; Antisense; GTTATCTGCATGACCGACCACATTG
>probe:Drosophila_2:1638315_s_at:523:671; Interrogation_Position=872; Antisense; TACGAGGTGATCGACGGACTGCCGT
>probe:Drosophila_2:1638315_s_at:303:71; Interrogation_Position=918; Antisense; AGGCGAAGCGCACCGAGCTACTGAA
>probe:Drosophila_2:1638315_s_at:174:669; Interrogation_Position=936; Antisense; TACTGAAACTCATCCTGTCGCTGGG
>probe:Drosophila_2:1638315_s_at:650:69; Interrogation_Position=974; Antisense; AGGCTAGCGAGGATTGCCCTGCCGA

Paste this into a BLAST search page for me
CGCCCACAGCCGAGTAGTTTTTAAGTGGGTTTAGTTTTCCTTGCCGAATGAATTGAGGCGGTGAGTCGGCATATTACAAAACGCGTTGGCTTCGAATTCAAGACCTTCTATCACTTCGATTCGTAGGGCAACTCCCTGGAGCTGATGAACATCAAGGACCTGCTTGGCGTCCGAAAGGCGAACGGCTACGACTGTGGCATGACTGTGGCATCCATGTTATCTGCAGTTATCTGCATGACCGACCACATTGTACGAGGTGATCGACGGACTGCCGTAGGCGAAGCGCACCGAGCTACTGAATACTGAAACTCATCCTGTCGCTGGGAGGCTAGCGAGGATTGCCCTGCCGA

Full Affymetrix probeset data:

Annotations for 1638315_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime