FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638317_at:

>probe:Drosophila_2:1638317_at:39:91; Interrogation_Position=1115; Antisense; AGTAGCCTTGATACGCTGACGAAGC
>probe:Drosophila_2:1638317_at:324:5; Interrogation_Position=1160; Antisense; ATTGTGGATCTCTTTGTGGTGCGCC
>probe:Drosophila_2:1638317_at:216:95; Interrogation_Position=1216; Antisense; AGTTGGCATTTGCAAGGGCGCTTCT
>probe:Drosophila_2:1638317_at:544:523; Interrogation_Position=1231; Antisense; GGGCGCTTCTTACATCTTGTACAAT
>probe:Drosophila_2:1638317_at:458:161; Interrogation_Position=1251; Antisense; ACAATTCAGCACGTCTGGAGGCGCT
>probe:Drosophila_2:1638317_at:403:577; Interrogation_Position=1270; Antisense; GGCGCTGCTGCGCAAATTTAATTAT
>probe:Drosophila_2:1638317_at:490:423; Interrogation_Position=1316; Antisense; GAGAAACTGCCACTGCTGGATGAGA
>probe:Drosophila_2:1638317_at:607:425; Interrogation_Position=1337; Antisense; GAGATCGATCTCAGCGTTCTAGAGG
>probe:Drosophila_2:1638317_at:347:467; Interrogation_Position=1378; Antisense; GTTGATTTATGGCTACCTCCTTACC
>probe:Drosophila_2:1638317_at:638:341; Interrogation_Position=1465; Antisense; GCTTGTGCACTATGTTGAGAACCTG
>probe:Drosophila_2:1638317_at:399:315; Interrogation_Position=1496; Antisense; GCCTTCAGTCGCTTCTATTATCATA
>probe:Drosophila_2:1638317_at:529:371; Interrogation_Position=1522; Antisense; GAAGGTCCTTCTTCAGAAGCGCGAT
>probe:Drosophila_2:1638317_at:223:657; Interrogation_Position=1551; Antisense; TAATGCCGATCTTGTACGCCAGGAT
>probe:Drosophila_2:1638317_at:23:401; Interrogation_Position=1596; Antisense; GACAGGTCCTGAATACGGCTCTGGC

Paste this into a BLAST search page for me
AGTAGCCTTGATACGCTGACGAAGCATTGTGGATCTCTTTGTGGTGCGCCAGTTGGCATTTGCAAGGGCGCTTCTGGGCGCTTCTTACATCTTGTACAATACAATTCAGCACGTCTGGAGGCGCTGGCGCTGCTGCGCAAATTTAATTATGAGAAACTGCCACTGCTGGATGAGAGAGATCGATCTCAGCGTTCTAGAGGGTTGATTTATGGCTACCTCCTTACCGCTTGTGCACTATGTTGAGAACCTGGCCTTCAGTCGCTTCTATTATCATAGAAGGTCCTTCTTCAGAAGCGCGATTAATGCCGATCTTGTACGCCAGGATGACAGGTCCTGAATACGGCTCTGGC

Full Affymetrix probeset data:

Annotations for 1638317_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720