FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638318_at:

>probe:Drosophila_2:1638318_at:608:655; Interrogation_Position=1023; Antisense; TAAGTTACCATTAGCTCTGTTTTAA
>probe:Drosophila_2:1638318_at:568:5; Interrogation_Position=1066; Antisense; ATTGCTGCAACTTTCGAATGTACTG
>probe:Drosophila_2:1638318_at:606:369; Interrogation_Position=1081; Antisense; GAATGTACTGTGACCTTCACCTGTG
>probe:Drosophila_2:1638318_at:215:181; Interrogation_Position=1114; Antisense; AAAAAGCAACTCCAAGGCACCTAGA
>probe:Drosophila_2:1638318_at:86:559; Interrogation_Position=1129; Antisense; GGCACCTAGAAAGCTTTCGCCTTAA
>probe:Drosophila_2:1638318_at:661:395; Interrogation_Position=1157; Antisense; GAAATTTGCATGTCAACGGTCACTT
>probe:Drosophila_2:1638318_at:554:479; Interrogation_Position=1212; Antisense; GTTTCGCTTTTATCATTGACCACAG
>probe:Drosophila_2:1638318_at:46:335; Interrogation_Position=1236; Antisense; GCTGACCACACACTTCGACGGAAAA
>probe:Drosophila_2:1638318_at:573:65; Interrogation_Position=1290; Antisense; ATGGAGGCAAACACGCTCACTAAGC
>probe:Drosophila_2:1638318_at:717:407; Interrogation_Position=1343; Antisense; GACGTTTCCACACCTTTGAGCCGGG
>probe:Drosophila_2:1638318_at:213:365; Interrogation_Position=1368; Antisense; GAATTTGGGCGTTTCGCTTGGCCAC
>probe:Drosophila_2:1638318_at:95:313; Interrogation_Position=1388; Antisense; GCCACCATGTGGGATAGCGAATAGC
>probe:Drosophila_2:1638318_at:250:653; Interrogation_Position=1419; Antisense; TAATTGCTGCACAGGCAGGTTCCTG
>probe:Drosophila_2:1638318_at:656:265; Interrogation_Position=1434; Antisense; CAGGTTCCTGGTTTGCTAATTATTC

Paste this into a BLAST search page for me
TAAGTTACCATTAGCTCTGTTTTAAATTGCTGCAACTTTCGAATGTACTGGAATGTACTGTGACCTTCACCTGTGAAAAAGCAACTCCAAGGCACCTAGAGGCACCTAGAAAGCTTTCGCCTTAAGAAATTTGCATGTCAACGGTCACTTGTTTCGCTTTTATCATTGACCACAGGCTGACCACACACTTCGACGGAAAAATGGAGGCAAACACGCTCACTAAGCGACGTTTCCACACCTTTGAGCCGGGGAATTTGGGCGTTTCGCTTGGCCACGCCACCATGTGGGATAGCGAATAGCTAATTGCTGCACAGGCAGGTTCCTGCAGGTTCCTGGTTTGCTAATTATTC

Full Affymetrix probeset data:

Annotations for 1638318_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720