Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638319_at:

>probe:Drosophila_2:1638319_at:609:641; Interrogation_Position=1716; Antisense; TCTGCGGCGGCAAGAACAACCATGT
>probe:Drosophila_2:1638319_at:279:203; Interrogation_Position=1733; Antisense; AACCATGTCACGACTGGCTGTGTAA
>probe:Drosophila_2:1638319_at:558:493; Interrogation_Position=1754; Antisense; GTAATCACCCACGTTTATCCGGAGG
>probe:Drosophila_2:1638319_at:661:205; Interrogation_Position=1796; Antisense; AAGCGCCTCAAGATCTTTGACCACA
>probe:Drosophila_2:1638319_at:286:169; Interrogation_Position=1831; Antisense; AAATGGTACGCCAATCCACGTGGGA
>probe:Drosophila_2:1638319_at:548:593; Interrogation_Position=1851; Antisense; TGGGATCCATGACGACACTGAAGGT
>probe:Drosophila_2:1638319_at:151:373; Interrogation_Position=1870; Antisense; GAAGGTCCATCAGTTATTCCACACC
>probe:Drosophila_2:1638319_at:723:419; Interrogation_Position=1901; Antisense; GAGAAAGCGGTCACCCTAACGGTCT
>probe:Drosophila_2:1638319_at:296:335; Interrogation_Position=1931; Antisense; GCTGATCCTCCGGAGCTGGAAAAGT
>probe:Drosophila_2:1638319_at:237:589; Interrogation_Position=2020; Antisense; TGGATGTACCATCGCGGACTTGATT
>probe:Drosophila_2:1638319_at:483:617; Interrogation_Position=2076; Antisense; TGCAGCGCGGCGATATTATCACCAA
>probe:Drosophila_2:1638319_at:618:227; Interrogation_Position=2105; Antisense; AATGGCGATGCCTTGGAGGGTCTTC
>probe:Drosophila_2:1638319_at:647:81; Interrogation_Position=2121; Antisense; AGGGTCTTCCGTTCCAGGTGTGCTA
>probe:Drosophila_2:1638319_at:417:225; Interrogation_Position=2225; Antisense; AAGGCCTAGAGACGATCCTCATTCT

Paste this into a BLAST search page for me
TCTGCGGCGGCAAGAACAACCATGTAACCATGTCACGACTGGCTGTGTAAGTAATCACCCACGTTTATCCGGAGGAAGCGCCTCAAGATCTTTGACCACAAAATGGTACGCCAATCCACGTGGGATGGGATCCATGACGACACTGAAGGTGAAGGTCCATCAGTTATTCCACACCGAGAAAGCGGTCACCCTAACGGTCTGCTGATCCTCCGGAGCTGGAAAAGTTGGATGTACCATCGCGGACTTGATTTGCAGCGCGGCGATATTATCACCAAAATGGCGATGCCTTGGAGGGTCTTCAGGGTCTTCCGTTCCAGGTGTGCTAAAGGCCTAGAGACGATCCTCATTCT

Full Affymetrix probeset data:

Annotations for 1638319_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime