FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638320_at:

>probe:Drosophila_2:1638320_at:248:395; Interrogation_Position=111; Antisense; GAAATCCAACGCAACTGCGGCTTAT
>probe:Drosophila_2:1638320_at:333:571; Interrogation_Position=129; Antisense; GGCTTATGTACCGTATGCGCAATTT
>probe:Drosophila_2:1638320_at:199:57; Interrogation_Position=13; Antisense; ATGAGCAATTTTACTCCGCTGCTTG
>probe:Drosophila_2:1638320_at:641:361; Interrogation_Position=147; Antisense; GCAATTTACTAACTCAGACAGGCTG
>probe:Drosophila_2:1638320_at:709:151; Interrogation_Position=164; Antisense; ACAGGCTGGCTGGTCTAAATGATAG
>probe:Drosophila_2:1638320_at:315:59; Interrogation_Position=182; Antisense; ATGATAGCAATGTGCTCGGCTCGCC
>probe:Drosophila_2:1638320_at:123:641; Interrogation_Position=197; Antisense; TCGGCTCGCCGGCAAATTATGCAAA
>probe:Drosophila_2:1638320_at:349:683; Interrogation_Position=214; Antisense; TATGCAAATGCTGCTGCTCGAGCGT
>probe:Drosophila_2:1638320_at:88:283; Interrogation_Position=230; Antisense; CTCGAGCGTCGTGGCATATGAGCAA
>probe:Drosophila_2:1638320_at:246:345; Interrogation_Position=265; Antisense; GCATACGCCGAGTGTTCCATTAAAC
>probe:Drosophila_2:1638320_at:170:179; Interrogation_Position=286; Antisense; AAACACTCATGTGGGCGGGACGAAC
>probe:Drosophila_2:1638320_at:149:263; Interrogation_Position=46; Antisense; CAGCGTGCCCAATTTGTCAGCAATG
>probe:Drosophila_2:1638320_at:452:243; Interrogation_Position=56; Antisense; AATTTGTCAGCAATGCCTCCTGCCG
>probe:Drosophila_2:1638320_at:382:497; Interrogation_Position=80; Antisense; GTCTTACCTCCAAGCACACAATATG

Paste this into a BLAST search page for me
GAAATCCAACGCAACTGCGGCTTATGGCTTATGTACCGTATGCGCAATTTATGAGCAATTTTACTCCGCTGCTTGGCAATTTACTAACTCAGACAGGCTGACAGGCTGGCTGGTCTAAATGATAGATGATAGCAATGTGCTCGGCTCGCCTCGGCTCGCCGGCAAATTATGCAAATATGCAAATGCTGCTGCTCGAGCGTCTCGAGCGTCGTGGCATATGAGCAAGCATACGCCGAGTGTTCCATTAAACAAACACTCATGTGGGCGGGACGAACCAGCGTGCCCAATTTGTCAGCAATGAATTTGTCAGCAATGCCTCCTGCCGGTCTTACCTCCAAGCACACAATATG

Full Affymetrix probeset data:

Annotations for 1638320_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720