Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638322_at:

>probe:Drosophila_2:1638322_at:51:663; Interrogation_Position=1056; Antisense; TAAAGTGCCCCAGCGAATGGTGTTG
>probe:Drosophila_2:1638322_at:543:699; Interrogation_Position=1100; Antisense; TTTTTATCACTCACGGCGGCTTGCA
>probe:Drosophila_2:1638322_at:398:309; Interrogation_Position=1171; Antisense; CCACTGTTCTTCGACCAATTCAATA
>probe:Drosophila_2:1638322_at:366:667; Interrogation_Position=1199; Antisense; TACATCGAGTGCAGTTAGCCGGAAT
>probe:Drosophila_2:1638322_at:263:587; Interrogation_Position=1235; Antisense; TGGACCCCAACGACTTGAACGCAGA
>probe:Drosophila_2:1638322_at:713:381; Interrogation_Position=1251; Antisense; GAACGCAGACACACTCATCGAAACT
>probe:Drosophila_2:1638322_at:529:387; Interrogation_Position=1291; Antisense; GAAAATCCTAGCTATGCCCAGAGAG
>probe:Drosophila_2:1638322_at:722:527; Interrogation_Position=1340; Antisense; GGGATCGGCCAATGAGTCCTCTGGA
>probe:Drosophila_2:1638322_at:177:399; Interrogation_Position=1363; Antisense; GACACTGCCATCTGGTGGACGGAGT
>probe:Drosophila_2:1638322_at:83:431; Interrogation_Position=1384; Antisense; GAGTACGCTCTACGGAATCGGGATA
>probe:Drosophila_2:1638322_at:557:29; Interrogation_Position=1406; Antisense; ATACTTCCCATATGCGTCTCAATGT
>probe:Drosophila_2:1638322_at:216:551; Interrogation_Position=1434; Antisense; GGAGATTCCTCTTATGCGATACTAC
>probe:Drosophila_2:1638322_at:304:105; Interrogation_Position=1459; Antisense; AGACTCGACAGCATACTAACCTTTG
>probe:Drosophila_2:1638322_at:217:667; Interrogation_Position=1472; Antisense; TACTAACCTTTGGAGTTCGCCTTGG

Paste this into a BLAST search page for me
TAAAGTGCCCCAGCGAATGGTGTTGTTTTTATCACTCACGGCGGCTTGCACCACTGTTCTTCGACCAATTCAATATACATCGAGTGCAGTTAGCCGGAATTGGACCCCAACGACTTGAACGCAGAGAACGCAGACACACTCATCGAAACTGAAAATCCTAGCTATGCCCAGAGAGGGGATCGGCCAATGAGTCCTCTGGAGACACTGCCATCTGGTGGACGGAGTGAGTACGCTCTACGGAATCGGGATAATACTTCCCATATGCGTCTCAATGTGGAGATTCCTCTTATGCGATACTACAGACTCGACAGCATACTAACCTTTGTACTAACCTTTGGAGTTCGCCTTGG

Full Affymetrix probeset data:

Annotations for 1638322_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime