FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638323_at:

>probe:Drosophila_2:1638323_at:108:181; Interrogation_Position=409; Antisense; AAACACCTGCTGCTGCCAGTGGAAA
>probe:Drosophila_2:1638323_at:553:625; Interrogation_Position=456; Antisense; TGCCCAGGTGACATCCAATCATTTA
>probe:Drosophila_2:1638323_at:214:503; Interrogation_Position=512; Antisense; GTCGCCACGCAGGAGGACACGGATA
>probe:Drosophila_2:1638323_at:119:381; Interrogation_Position=533; Antisense; GATACGGCAACGGTTACGGACTCGT
>probe:Drosophila_2:1638323_at:729:349; Interrogation_Position=562; Antisense; GCAGTAGCGGGCACCATGAACGCCA
>probe:Drosophila_2:1638323_at:44:595; Interrogation_Position=734; Antisense; TGTGCATCATCGAGACCGTGCGCAT
>probe:Drosophila_2:1638323_at:676:265; Interrogation_Position=777; Antisense; CAGTCTAAGCGATCGTGGCTGGCAA
>probe:Drosophila_2:1638323_at:230:563; Interrogation_Position=797; Antisense; GGCAAGCAACCGCATCCGTAATATT
>probe:Drosophila_2:1638323_at:663:321; Interrogation_Position=828; Antisense; GCCCAGTCTTGCTATTGTTATCTAC
>probe:Drosophila_2:1638323_at:333:87; Interrogation_Position=898; Antisense; AGTGCCTTAATGATCACCCTACAAG
>probe:Drosophila_2:1638323_at:366:251; Interrogation_Position=919; Antisense; CAAGGTGCTGAACTAGTCTACGCCA
>probe:Drosophila_2:1638323_at:92:499; Interrogation_Position=934; Antisense; GTCTACGCCAGCATATTCATTTGTA
>probe:Drosophila_2:1638323_at:401:19; Interrogation_Position=952; Antisense; ATTTGTACAATGTGTCGCCCCGTCA
>probe:Drosophila_2:1638323_at:544:123; Interrogation_Position=982; Antisense; ACCTAGCAGTTGATAAGCCGCGTTG

Paste this into a BLAST search page for me
AAACACCTGCTGCTGCCAGTGGAAATGCCCAGGTGACATCCAATCATTTAGTCGCCACGCAGGAGGACACGGATAGATACGGCAACGGTTACGGACTCGTGCAGTAGCGGGCACCATGAACGCCATGTGCATCATCGAGACCGTGCGCATCAGTCTAAGCGATCGTGGCTGGCAAGGCAAGCAACCGCATCCGTAATATTGCCCAGTCTTGCTATTGTTATCTACAGTGCCTTAATGATCACCCTACAAGCAAGGTGCTGAACTAGTCTACGCCAGTCTACGCCAGCATATTCATTTGTAATTTGTACAATGTGTCGCCCCGTCAACCTAGCAGTTGATAAGCCGCGTTG

Full Affymetrix probeset data:

Annotations for 1638323_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720