Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638325_at:

>probe:Drosophila_2:1638325_at:662:285; Interrogation_Position=1025; Antisense; CTGGGAGCACCCGATGATTACATTG
>probe:Drosophila_2:1638325_at:640:423; Interrogation_Position=1049; Antisense; GAGAAATTGTCCACCATCTTCTGGT
>probe:Drosophila_2:1638325_at:672:383; Interrogation_Position=1151; Antisense; GAACTGGAGTATTGCCTCACGGACA
>probe:Drosophila_2:1638325_at:685:435; Interrogation_Position=1202; Antisense; GAGGTCACTGGCGTCACCAAGTATC
>probe:Drosophila_2:1638325_at:435:217; Interrogation_Position=1220; Antisense; AAGTATCCCATTACTCAGTTCCAGC
>probe:Drosophila_2:1638325_at:596:123; Interrogation_Position=1242; Antisense; AGCCTCTGTACTATGTGGCCGATAG
>probe:Drosophila_2:1638325_at:396:663; Interrogation_Position=1294; Antisense; TAAATTTGCGAACTCGATTCCCCGA
>probe:Drosophila_2:1638325_at:323:471; Interrogation_Position=1328; Antisense; GTTCGCTACAATGCCTATACTCAGA
>probe:Drosophila_2:1638325_at:623:657; Interrogation_Position=1405; Antisense; TAACTCCGAGTTCCAGATTCTTCAG
>probe:Drosophila_2:1638325_at:159:463; Interrogation_Position=1420; Antisense; GATTCTTCAGAATGCCGTTGCCAAG
>probe:Drosophila_2:1638325_at:659:311; Interrogation_Position=1439; Antisense; GCCAAGCTGCGCGTCTGAGTAGAAT
>probe:Drosophila_2:1638325_at:613:669; Interrogation_Position=1478; Antisense; TACTCCCTCTCTTTACTTACTATTA
>probe:Drosophila_2:1638325_at:440:701; Interrogation_Position=973; Antisense; TTTTGCAGATCCAGCTTTTGCCCAA
>probe:Drosophila_2:1638325_at:400:649; Interrogation_Position=999; Antisense; TCAGTCAGGAGATCGGGCTAGCTTC

Paste this into a BLAST search page for me
CTGGGAGCACCCGATGATTACATTGGAGAAATTGTCCACCATCTTCTGGTGAACTGGAGTATTGCCTCACGGACAGAGGTCACTGGCGTCACCAAGTATCAAGTATCCCATTACTCAGTTCCAGCAGCCTCTGTACTATGTGGCCGATAGTAAATTTGCGAACTCGATTCCCCGAGTTCGCTACAATGCCTATACTCAGATAACTCCGAGTTCCAGATTCTTCAGGATTCTTCAGAATGCCGTTGCCAAGGCCAAGCTGCGCGTCTGAGTAGAATTACTCCCTCTCTTTACTTACTATTATTTTGCAGATCCAGCTTTTGCCCAATCAGTCAGGAGATCGGGCTAGCTTC

Full Affymetrix probeset data:

Annotations for 1638325_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime