FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638326_at:

>probe:Drosophila_2:1638326_at:34:523; Interrogation_Position=320; Antisense; GGGAAACCTCACCTGTTGCGGGTCA
>probe:Drosophila_2:1638326_at:712:467; Interrogation_Position=334; Antisense; GTTGCGGGTCACGAGGATCCCATCA
>probe:Drosophila_2:1638326_at:188:147; Interrogation_Position=407; Antisense; ACTTCGAGGGCAAGTTCCGGTGTCT
>probe:Drosophila_2:1638326_at:662:631; Interrogation_Position=422; Antisense; TCCGGTGTCTGGACGGCTCCAAAGA
>probe:Drosophila_2:1638326_at:658:161; Interrogation_Position=442; Antisense; AAAGAGATCCCGTTCGACCACCTGA
>probe:Drosophila_2:1638326_at:252:381; Interrogation_Position=465; Antisense; GAACGACAACTACTGCGACTGTGAG
>probe:Drosophila_2:1638326_at:169:327; Interrogation_Position=534; Antisense; GCGATTCTACTGTCGCTACCAGAAG
>probe:Drosophila_2:1638326_at:678:339; Interrogation_Position=548; Antisense; GCTACCAGAAGCGTCACATCACGGG
>probe:Drosophila_2:1638326_at:195:113; Interrogation_Position=598; Antisense; AGCAGCCGCATTAATGACCACGTGT
>probe:Drosophila_2:1638326_at:55:57; Interrogation_Position=611; Antisense; ATGACCACGTGTGCGACTGCTGCGA
>probe:Drosophila_2:1638326_at:316:553; Interrogation_Position=650; Antisense; GGAGCACGGCGACCAAGTGTCCCAA
>probe:Drosophila_2:1638326_at:553:221; Interrogation_Position=664; Antisense; AAGTGTCCCAACGACTGTGCGTAGT
>probe:Drosophila_2:1638326_at:232:597; Interrogation_Position=743; Antisense; TGTGCACCTAGGACACCAATCTCAA
>probe:Drosophila_2:1638326_at:184:525; Interrogation_Position=781; Antisense; GGGCGGCGCATCACAAGCGATATTT

Paste this into a BLAST search page for me
GGGAAACCTCACCTGTTGCGGGTCAGTTGCGGGTCACGAGGATCCCATCAACTTCGAGGGCAAGTTCCGGTGTCTTCCGGTGTCTGGACGGCTCCAAAGAAAAGAGATCCCGTTCGACCACCTGAGAACGACAACTACTGCGACTGTGAGGCGATTCTACTGTCGCTACCAGAAGGCTACCAGAAGCGTCACATCACGGGAGCAGCCGCATTAATGACCACGTGTATGACCACGTGTGCGACTGCTGCGAGGAGCACGGCGACCAAGTGTCCCAAAAGTGTCCCAACGACTGTGCGTAGTTGTGCACCTAGGACACCAATCTCAAGGGCGGCGCATCACAAGCGATATTT

Full Affymetrix probeset data:

Annotations for 1638326_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720