FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638329_at:

>probe:Drosophila_2:1638329_at:371:597; Interrogation_Position=1064; Antisense; TGTGCTGTGCTTTGTGTGCGCCTGT
>probe:Drosophila_2:1638329_at:567:281; Interrogation_Position=553; Antisense; CCGACTTTGGGATCGCGAACGTTCA
>probe:Drosophila_2:1638329_at:712:263; Interrogation_Position=584; Antisense; CAGCACTCAACTGCAGGCGGGCATG
>probe:Drosophila_2:1638329_at:505:151; Interrogation_Position=622; Antisense; ACATGGCCCCGGAGGCGATGTCCAG
>probe:Drosophila_2:1638329_at:170:359; Interrogation_Position=652; Antisense; GCAAGGTGGATTTCAAGTCGGACGT
>probe:Drosophila_2:1638329_at:486:523; Interrogation_Position=687; Antisense; GGGCTAGTCCTCTACGAGCTGTGCC
>probe:Drosophila_2:1638329_at:289:717; Interrogation_Position=726; Antisense; TTCGCCGCGTTTCTCGACAAGAACG
>probe:Drosophila_2:1638329_at:55:671; Interrogation_Position=828; Antisense; TACGATCCCGTGTGGGCGCAAGTTT
>probe:Drosophila_2:1638329_at:457:91; Interrogation_Position=848; Antisense; AGTTTGCGAGCTGATGGTCGTTTAC
>probe:Drosophila_2:1638329_at:561:637; Interrogation_Position=865; Antisense; TCGTTTACGAGCAGGAGCGCCGCAT
>probe:Drosophila_2:1638329_at:450:611; Interrogation_Position=925; Antisense; TGACTGTGACCCTCTACAAGCATTA
>probe:Drosophila_2:1638329_at:86:209; Interrogation_Position=942; Antisense; AAGCATTACTTCAGCTACAGCTACT
>probe:Drosophila_2:1638329_at:590:229; Interrogation_Position=977; Antisense; AATGGTCAGCTCACCAGCACGAGGA
>probe:Drosophila_2:1638329_at:142:437; Interrogation_Position=997; Antisense; GAGGAGACCTCAACAAATATTTCAT

Paste this into a BLAST search page for me
TGTGCTGTGCTTTGTGTGCGCCTGTCCGACTTTGGGATCGCGAACGTTCACAGCACTCAACTGCAGGCGGGCATGACATGGCCCCGGAGGCGATGTCCAGGCAAGGTGGATTTCAAGTCGGACGTGGGCTAGTCCTCTACGAGCTGTGCCTTCGCCGCGTTTCTCGACAAGAACGTACGATCCCGTGTGGGCGCAAGTTTAGTTTGCGAGCTGATGGTCGTTTACTCGTTTACGAGCAGGAGCGCCGCATTGACTGTGACCCTCTACAAGCATTAAAGCATTACTTCAGCTACAGCTACTAATGGTCAGCTCACCAGCACGAGGAGAGGAGACCTCAACAAATATTTCAT

Full Affymetrix probeset data:

Annotations for 1638329_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720