FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638330_at:

>probe:Drosophila_2:1638330_at:96:215; Interrogation_Position=1126; Antisense; AAGTTGTTTTGGTCCCATGGCGGCT
>probe:Drosophila_2:1638330_at:392:65; Interrogation_Position=1142; Antisense; ATGGCGGCTTACTTGGAACCACTGA
>probe:Drosophila_2:1638330_at:667:41; Interrogation_Position=1167; Antisense; ATCGGTGCATTGTGGCAAACCCCTA
>probe:Drosophila_2:1638330_at:622:495; Interrogation_Position=1195; Antisense; GTCACCCCAATCTACGGAGATCAAT
>probe:Drosophila_2:1638330_at:465:455; Interrogation_Position=1213; Antisense; GATCAATTCCTTAATGCATTCTCGG
>probe:Drosophila_2:1638330_at:297:465; Interrogation_Position=1263; Antisense; GTTGGACTACCAAGACATCACTGTA
>probe:Drosophila_2:1638330_at:723:679; Interrogation_Position=1330; Antisense; TATGCCCAACGATCTCTTGAGGTCT
>probe:Drosophila_2:1638330_at:153:105; Interrogation_Position=1379; Antisense; AGACGCCTCTGGAATCAGCCATTTG
>probe:Drosophila_2:1638330_at:468:229; Interrogation_Position=1426; Antisense; AATGGATTGATTGCCGCCAGACTAC
>probe:Drosophila_2:1638330_at:464:105; Interrogation_Position=1444; Antisense; AGACTACTTCAATCTCCAGGCATAG
>probe:Drosophila_2:1638330_at:411:543; Interrogation_Position=1477; Antisense; GGATTTGTCTACCATTCACTGGATA
>probe:Drosophila_2:1638330_at:58:455; Interrogation_Position=1498; Antisense; GATAGTGTAGCCCTGATCCTGTTAC
>probe:Drosophila_2:1638330_at:690:605; Interrogation_Position=1535; Antisense; TGATCCTAGTCCTATGCTATCTGTG
>probe:Drosophila_2:1638330_at:428:563; Interrogation_Position=1565; Antisense; GGAATCCATCGAAGTTGGCCCACAA

Paste this into a BLAST search page for me
AAGTTGTTTTGGTCCCATGGCGGCTATGGCGGCTTACTTGGAACCACTGAATCGGTGCATTGTGGCAAACCCCTAGTCACCCCAATCTACGGAGATCAATGATCAATTCCTTAATGCATTCTCGGGTTGGACTACCAAGACATCACTGTATATGCCCAACGATCTCTTGAGGTCTAGACGCCTCTGGAATCAGCCATTTGAATGGATTGATTGCCGCCAGACTACAGACTACTTCAATCTCCAGGCATAGGGATTTGTCTACCATTCACTGGATAGATAGTGTAGCCCTGATCCTGTTACTGATCCTAGTCCTATGCTATCTGTGGGAATCCATCGAAGTTGGCCCACAA

Full Affymetrix probeset data:

Annotations for 1638330_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720