Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638331_s_at:

>probe:Drosophila_2:1638331_s_at:589:129; Interrogation_Position=156; Antisense; ACCATGGATTCCGATTTGTACGATG
>probe:Drosophila_2:1638331_s_at:500:479; Interrogation_Position=182; Antisense; GTTTGGCAACTATATTGGCCCCGAT
>probe:Drosophila_2:1638331_s_at:689:579; Interrogation_Position=197; Antisense; TGGCCCCGATTTAGACAGCGACGAG
>probe:Drosophila_2:1638331_s_at:459:105; Interrogation_Position=229; Antisense; AGCAAAGTATTTATGGGCAACCCGA
>probe:Drosophila_2:1638331_s_at:317:55; Interrogation_Position=262; Antisense; ATGACCCAGAGGACGCCATGGACGA
>probe:Drosophila_2:1638331_s_at:559:79; Interrogation_Position=322; Antisense; AGGTGACCGCCGTGGTTTTGCACGA
>probe:Drosophila_2:1638331_s_at:183:477; Interrogation_Position=336; Antisense; GTTTTGCACGAGGACAAACGCTACT
>probe:Drosophila_2:1638331_s_at:551:211; Interrogation_Position=34; Antisense; AAGAACAGCGTGTTTGCAGTCCGCG
>probe:Drosophila_2:1638331_s_at:298:175; Interrogation_Position=351; Antisense; AAACGCTACTATCCGTCAGCAGTTG
>probe:Drosophila_2:1638331_s_at:726:649; Interrogation_Position=366; Antisense; TCAGCAGTTGAGGTCTACGGCCCGG
>probe:Drosophila_2:1638331_s_at:124:671; Interrogation_Position=381; Antisense; TACGGCCCGGATGTGGAGACCATTG
>probe:Drosophila_2:1638331_s_at:586:397; Interrogation_Position=432; Antisense; GACAAGCCGCTTATAGAGCCAGTGA
>probe:Drosophila_2:1638331_s_at:720:265; Interrogation_Position=451; Antisense; CAGTGAAGAAGCTCAAGTTCCAGAT
>probe:Drosophila_2:1638331_s_at:343:723; Interrogation_Position=47; Antisense; TTGCAGTCCGCGTTTTTGTGTAAAA

Paste this into a BLAST search page for me
ACCATGGATTCCGATTTGTACGATGGTTTGGCAACTATATTGGCCCCGATTGGCCCCGATTTAGACAGCGACGAGAGCAAAGTATTTATGGGCAACCCGAATGACCCAGAGGACGCCATGGACGAAGGTGACCGCCGTGGTTTTGCACGAGTTTTGCACGAGGACAAACGCTACTAAGAACAGCGTGTTTGCAGTCCGCGAAACGCTACTATCCGTCAGCAGTTGTCAGCAGTTGAGGTCTACGGCCCGGTACGGCCCGGATGTGGAGACCATTGGACAAGCCGCTTATAGAGCCAGTGACAGTGAAGAAGCTCAAGTTCCAGATTTGCAGTCCGCGTTTTTGTGTAAAA

Full Affymetrix probeset data:

Annotations for 1638331_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime