FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638332_at:

>probe:Drosophila_2:1638332_at:55:85; Interrogation_Position=1011; Antisense; AGTGGATTGCTCCTCGATCGGCGAT
>probe:Drosophila_2:1638332_at:364:575; Interrogation_Position=1030; Antisense; GGCGATCTTCCGGACATTGTCTTCA
>probe:Drosophila_2:1638332_at:637:555; Interrogation_Position=1067; Antisense; GGAAGTTCCCCTTGAAGTCTAGCGA
>probe:Drosophila_2:1638332_at:424:179; Interrogation_Position=1110; Antisense; AAACACTTGTGTCTCGGGATTCACC
>probe:Drosophila_2:1638332_at:687:381; Interrogation_Position=1140; Antisense; GAACGGCAACTCCTTGTTGATTCTG
>probe:Drosophila_2:1638332_at:354:463; Interrogation_Position=1158; Antisense; GATTCTGGGCGAGATCTTCCTGGGC
>probe:Drosophila_2:1638332_at:319:321; Interrogation_Position=1181; Antisense; GCGCCTACTATACGACCTACGATAT
>probe:Drosophila_2:1638332_at:396:257; Interrogation_Position=798; Antisense; CAGCGGGTGTTTGACCTATGTGCCA
>probe:Drosophila_2:1638332_at:170:63; Interrogation_Position=815; Antisense; ATGTGCCAGTTTCCAGCGCAGGATA
>probe:Drosophila_2:1638332_at:462:27; Interrogation_Position=904; Antisense; ATACTCGATGTAGGCACTTCCCTAA
>probe:Drosophila_2:1638332_at:472:149; Interrogation_Position=919; Antisense; ACTTCCCTAATTGTTGTGCCTGAGC
>probe:Drosophila_2:1638332_at:361:505; Interrogation_Position=934; Antisense; GTGCCTGAGCAAGTCCTAGATACCA
>probe:Drosophila_2:1638332_at:376:1; Interrogation_Position=967; Antisense; ATATTGGGAGTTCTCAACCCGACGG
>probe:Drosophila_2:1638332_at:574:201; Interrogation_Position=982; Antisense; AACCCGACGGCTTCGAATGGAGTCT

Paste this into a BLAST search page for me
AGTGGATTGCTCCTCGATCGGCGATGGCGATCTTCCGGACATTGTCTTCAGGAAGTTCCCCTTGAAGTCTAGCGAAAACACTTGTGTCTCGGGATTCACCGAACGGCAACTCCTTGTTGATTCTGGATTCTGGGCGAGATCTTCCTGGGCGCGCCTACTATACGACCTACGATATCAGCGGGTGTTTGACCTATGTGCCAATGTGCCAGTTTCCAGCGCAGGATAATACTCGATGTAGGCACTTCCCTAAACTTCCCTAATTGTTGTGCCTGAGCGTGCCTGAGCAAGTCCTAGATACCAATATTGGGAGTTCTCAACCCGACGGAACCCGACGGCTTCGAATGGAGTCT

Full Affymetrix probeset data:

Annotations for 1638332_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720