FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638333_at:

>probe:Drosophila_2:1638333_at:302:39; Interrogation_Position=1008; Antisense; ATCGGCGACAAACCTTGTTCTTCTG
>probe:Drosophila_2:1638333_at:709:643; Interrogation_Position=1026; Antisense; TCTTCTGCGGTCACAATGAGTTCCA
>probe:Drosophila_2:1638333_at:398:57; Interrogation_Position=1041; Antisense; ATGAGTTCCAGTGCACACCGTTCAA
>probe:Drosophila_2:1638333_at:128:527; Interrogation_Position=1123; Antisense; GGGAACCTGGGAGCACACGAATGAA
>probe:Drosophila_2:1638333_at:176:709; Interrogation_Position=1168; Antisense; TTACGTGCCTCGCTATTTTGCAGAT
>probe:Drosophila_2:1638333_at:716:447; Interrogation_Position=1190; Antisense; GATGCCTCCAAAATGTATTACTCGG
>probe:Drosophila_2:1638333_at:567:687; Interrogation_Position=1205; Antisense; TATTACTCGGGCTTACATGCGGATA
>probe:Drosophila_2:1638333_at:453:379; Interrogation_Position=1249; Antisense; GAAGCCGCACATTTCGCAGGATATT
>probe:Drosophila_2:1638333_at:428:17; Interrogation_Position=1312; Antisense; ATTTTATCAGTTTTGTCGCCAGCGG
>probe:Drosophila_2:1638333_at:479:467; Interrogation_Position=1336; Antisense; GTTGCACAAACAGTACTTGGCCCTC
>probe:Drosophila_2:1638333_at:219:693; Interrogation_Position=869; Antisense; TTTGTTCCCGGCAGGAGACGCAATA
>probe:Drosophila_2:1638333_at:257:261; Interrogation_Position=925; Antisense; CACCGAATTCGATCAATGCGTCACG
>probe:Drosophila_2:1638333_at:38:511; Interrogation_Position=964; Antisense; GTGCACCTACATCGAGAATTCTCTG
>probe:Drosophila_2:1638333_at:139:643; Interrogation_Position=983; Antisense; TCTCTGCTGGAACATGTGGGCGATC

Paste this into a BLAST search page for me
ATCGGCGACAAACCTTGTTCTTCTGTCTTCTGCGGTCACAATGAGTTCCAATGAGTTCCAGTGCACACCGTTCAAGGGAACCTGGGAGCACACGAATGAATTACGTGCCTCGCTATTTTGCAGATGATGCCTCCAAAATGTATTACTCGGTATTACTCGGGCTTACATGCGGATAGAAGCCGCACATTTCGCAGGATATTATTTTATCAGTTTTGTCGCCAGCGGGTTGCACAAACAGTACTTGGCCCTCTTTGTTCCCGGCAGGAGACGCAATACACCGAATTCGATCAATGCGTCACGGTGCACCTACATCGAGAATTCTCTGTCTCTGCTGGAACATGTGGGCGATC

Full Affymetrix probeset data:

Annotations for 1638333_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720