FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638334_at:

>probe:Drosophila_2:1638334_at:582:109; Interrogation_Position=1058; Antisense; AGAATGCCCGGGAGAGCTACGAGAA
>probe:Drosophila_2:1638334_at:504:41; Interrogation_Position=1097; Antisense; ATCTGGCCGAAGAGCACGAGCTGCG
>probe:Drosophila_2:1638334_at:444:187; Interrogation_Position=1132; Antisense; AACAAATTGCTCCTGCAACTGCAGA
>probe:Drosophila_2:1638334_at:259:659; Interrogation_Position=1164; Antisense; TAAGAAGTACGATACCAGCCTGGGC
>probe:Drosophila_2:1638334_at:171:437; Interrogation_Position=1216; Antisense; GAGGATCAGTATCTGGCTGCCAAGA
>probe:Drosophila_2:1638334_at:499:41; Interrogation_Position=1226; Antisense; ATCTGGCTGCCAAGAAGGTCCTCGA
>probe:Drosophila_2:1638334_at:291:535; Interrogation_Position=1242; Antisense; GGTCCTCGACGATTTTATGGTCCAG
>probe:Drosophila_2:1638334_at:92:667; Interrogation_Position=1267; Antisense; TACAGGCAGGAGGAGCGCATCTACA
>probe:Drosophila_2:1638334_at:55:553; Interrogation_Position=1338; Antisense; GGAGAAGCTGGTCATCTTCATGATG
>probe:Drosophila_2:1638334_at:76:525; Interrogation_Position=1367; Antisense; GGGCGGCGGGCAAGATTCAAAAATA
>probe:Drosophila_2:1638334_at:431:279; Interrogation_Position=1468; Antisense; CCCAAACCGGATCTCTGTATATTTC
>probe:Drosophila_2:1638334_at:93:23; Interrogation_Position=1524; Antisense; ATATATTCCAACCTTCTACTACTAC
>probe:Drosophila_2:1638334_at:528:567; Interrogation_Position=950; Antisense; GGCAGAACAACGTGGCCATTCAGAA
>probe:Drosophila_2:1638334_at:493:635; Interrogation_Position=993; Antisense; TCGCACGATGCGAAGCTACCACAAG

Paste this into a BLAST search page for me
AGAATGCCCGGGAGAGCTACGAGAAATCTGGCCGAAGAGCACGAGCTGCGAACAAATTGCTCCTGCAACTGCAGATAAGAAGTACGATACCAGCCTGGGCGAGGATCAGTATCTGGCTGCCAAGAATCTGGCTGCCAAGAAGGTCCTCGAGGTCCTCGACGATTTTATGGTCCAGTACAGGCAGGAGGAGCGCATCTACAGGAGAAGCTGGTCATCTTCATGATGGGGCGGCGGGCAAGATTCAAAAATACCCAAACCGGATCTCTGTATATTTCATATATTCCAACCTTCTACTACTACGGCAGAACAACGTGGCCATTCAGAATCGCACGATGCGAAGCTACCACAAG

Full Affymetrix probeset data:

Annotations for 1638334_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720