FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638335_at:

>probe:Drosophila_2:1638335_at:451:549; Interrogation_Position=1049; Antisense; GGAGTGGACCACTTTGACGCCAGTC
>probe:Drosophila_2:1638335_at:461:319; Interrogation_Position=1074; Antisense; GCCCGTGGTACTATCAGACCTGCAA
>probe:Drosophila_2:1638335_at:336:419; Interrogation_Position=1117; Antisense; GAGCTCTGGCTCAAGGAATCAACCT
>probe:Drosophila_2:1638335_at:52:565; Interrogation_Position=1131; Antisense; GGAATCAACCTTTTGGCACCAAGTT
>probe:Drosophila_2:1638335_at:284:307; Interrogation_Position=1157; Antisense; CCTGCCACACTTTACATCAATCTAT
>probe:Drosophila_2:1638335_at:556:605; Interrogation_Position=1186; Antisense; TGATGTCTTCAGTTCGCAATACGGA
>probe:Drosophila_2:1638335_at:413:487; Interrogation_Position=1239; Antisense; GTACCAACGAATACTTCGGCGGCAT
>probe:Drosophila_2:1638335_at:636:415; Interrogation_Position=1265; Antisense; GAGCCCGGCGTGGATAATATCTACA
>probe:Drosophila_2:1638335_at:93:383; Interrogation_Position=1301; Antisense; GAACTGGATCCCTGGAACCCGATGG
>probe:Drosophila_2:1638335_at:177:419; Interrogation_Position=1337; Antisense; GAGCAGGGAGCCACGGTCATCGCCA
>probe:Drosophila_2:1638335_at:69:275; Interrogation_Position=1370; Antisense; CATTGCTCAGACTTCGGATCGATCA
>probe:Drosophila_2:1638335_at:308:451; Interrogation_Position=1386; Antisense; GATCGATCAAGTCCACAGATTCCGA
>probe:Drosophila_2:1638335_at:242:7; Interrogation_Position=1404; Antisense; ATTCCGACGAAATGCGGGCCTCTAA
>probe:Drosophila_2:1638335_at:724:245; Interrogation_Position=1443; Antisense; AATTGGTTCGACAGTGGTTGGCCTA

Paste this into a BLAST search page for me
GGAGTGGACCACTTTGACGCCAGTCGCCCGTGGTACTATCAGACCTGCAAGAGCTCTGGCTCAAGGAATCAACCTGGAATCAACCTTTTGGCACCAAGTTCCTGCCACACTTTACATCAATCTATTGATGTCTTCAGTTCGCAATACGGAGTACCAACGAATACTTCGGCGGCATGAGCCCGGCGTGGATAATATCTACAGAACTGGATCCCTGGAACCCGATGGGAGCAGGGAGCCACGGTCATCGCCACATTGCTCAGACTTCGGATCGATCAGATCGATCAAGTCCACAGATTCCGAATTCCGACGAAATGCGGGCCTCTAAAATTGGTTCGACAGTGGTTGGCCTA

Full Affymetrix probeset data:

Annotations for 1638335_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720