Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638336_at:

>probe:Drosophila_2:1638336_at:241:485; Interrogation_Position=1860; Antisense; GTATGCGACCTTTGACCAGCTACTA
>probe:Drosophila_2:1638336_at:248:129; Interrogation_Position=1874; Antisense; ACCAGCTACTATGGGCGTGGCAAGC
>probe:Drosophila_2:1638336_at:92:367; Interrogation_Position=1901; Antisense; GAATCGTGCGTAAGTTCGGCCACCA
>probe:Drosophila_2:1638336_at:539:137; Interrogation_Position=1991; Antisense; ACGATGCCCACTTTGGCGGCAAATG
>probe:Drosophila_2:1638336_at:729:165; Interrogation_Position=2011; Antisense; AAATGCCATGAGTTCCGGCAGCACT
>probe:Drosophila_2:1638336_at:380:111; Interrogation_Position=2030; Antisense; AGCACTCTGAGCGTAATGCCCCGGG
>probe:Drosophila_2:1638336_at:658:313; Interrogation_Position=2054; Antisense; GCCATTAGTCCCCTGATGAGGCAAG
>probe:Drosophila_2:1638336_at:194:423; Interrogation_Position=2087; Antisense; GAGAACTCGGTGTAGACAAATCCCT
>probe:Drosophila_2:1638336_at:558:397; Interrogation_Position=2101; Antisense; GACAAATCCCTAGCAAGTGCATCTT
>probe:Drosophila_2:1638336_at:274:711; Interrogation_Position=2139; Antisense; TTCATTGAACTTTCCACTTCCGTGT
>probe:Drosophila_2:1638336_at:620:39; Interrogation_Position=2169; Antisense; ATCTGCGAGTGCGATTAGTTAGCTA
>probe:Drosophila_2:1638336_at:323:595; Interrogation_Position=2305; Antisense; TGTGAGCAGCTGAGAGCCCCATTAA
>probe:Drosophila_2:1638336_at:299:235; Interrogation_Position=2331; Antisense; AATCCAACCAACTCCATGCTATGAA
>probe:Drosophila_2:1638336_at:249:283; Interrogation_Position=2342; Antisense; CTCCATGCTATGAACTCCAACTGTA

Paste this into a BLAST search page for me
GTATGCGACCTTTGACCAGCTACTAACCAGCTACTATGGGCGTGGCAAGCGAATCGTGCGTAAGTTCGGCCACCAACGATGCCCACTTTGGCGGCAAATGAAATGCCATGAGTTCCGGCAGCACTAGCACTCTGAGCGTAATGCCCCGGGGCCATTAGTCCCCTGATGAGGCAAGGAGAACTCGGTGTAGACAAATCCCTGACAAATCCCTAGCAAGTGCATCTTTTCATTGAACTTTCCACTTCCGTGTATCTGCGAGTGCGATTAGTTAGCTATGTGAGCAGCTGAGAGCCCCATTAAAATCCAACCAACTCCATGCTATGAACTCCATGCTATGAACTCCAACTGTA

Full Affymetrix probeset data:

Annotations for 1638336_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime