FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638339_at:

>probe:Drosophila_2:1638339_at:136:31; Interrogation_Position=519; Antisense; ATAAGACTCCTTTGTACCCCATATG
>probe:Drosophila_2:1638339_at:656:23; Interrogation_Position=539; Antisense; ATATGCCGCGCATGGATGGCAAATC
>probe:Drosophila_2:1638339_at:692:565; Interrogation_Position=556; Antisense; GGCAAATCAACCCAAGAATCCAGCT
>probe:Drosophila_2:1638339_at:302:367; Interrogation_Position=571; Antisense; GAATCCAGCTGTGGGTGCATTTCAA
>probe:Drosophila_2:1638339_at:48:711; Interrogation_Position=591; Antisense; TTCAAACAGATGCTTCACTCACGGC
>probe:Drosophila_2:1638339_at:728:281; Interrogation_Position=634; Antisense; CGGCGAAGAAATCCTGTCCCAAATT
>probe:Drosophila_2:1638339_at:473:503; Interrogation_Position=649; Antisense; GTCCCAAATTAAAAGCGGCGAGATA
>probe:Drosophila_2:1638339_at:293:31; Interrogation_Position=671; Antisense; ATAAAGGTGATCAACCAGCTCCCGC
>probe:Drosophila_2:1638339_at:311:219; Interrogation_Position=701; Antisense; AAGTCCACGGATCTGCCCATAATTC
>probe:Drosophila_2:1638339_at:358:33; Interrogation_Position=719; Antisense; ATAATTCCGCCTCGTCTGGAGTTCA
>probe:Drosophila_2:1638339_at:271:183; Interrogation_Position=765; Antisense; AAAAGGCTCTCCAAGGTGCCAGTAC
>probe:Drosophila_2:1638339_at:86:453; Interrogation_Position=794; Antisense; GATCTTCTGTCCTCCAATATGAACC
>probe:Drosophila_2:1638339_at:643:507; Interrogation_Position=830; Antisense; GTGCGCGGACACTGGATAAAGCATA
>probe:Drosophila_2:1638339_at:265:55; Interrogation_Position=899; Antisense; ATGAGCTTGGTCTGCAAAAACTGAA

Paste this into a BLAST search page for me
ATAAGACTCCTTTGTACCCCATATGATATGCCGCGCATGGATGGCAAATCGGCAAATCAACCCAAGAATCCAGCTGAATCCAGCTGTGGGTGCATTTCAATTCAAACAGATGCTTCACTCACGGCCGGCGAAGAAATCCTGTCCCAAATTGTCCCAAATTAAAAGCGGCGAGATAATAAAGGTGATCAACCAGCTCCCGCAAGTCCACGGATCTGCCCATAATTCATAATTCCGCCTCGTCTGGAGTTCAAAAAGGCTCTCCAAGGTGCCAGTACGATCTTCTGTCCTCCAATATGAACCGTGCGCGGACACTGGATAAAGCATAATGAGCTTGGTCTGCAAAAACTGAA

Full Affymetrix probeset data:

Annotations for 1638339_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720