Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638342_at:

>probe:Drosophila_2:1638342_at:307:315; Interrogation_Position=320; Antisense; GCCTCTTCTCTGCTGGAAAAGGATG
>probe:Drosophila_2:1638342_at:713:53; Interrogation_Position=342; Antisense; ATGCAAAGCGTGTGTGCGCCATTCC
>probe:Drosophila_2:1638342_at:436:431; Interrogation_Position=391; Antisense; GAGTCATTCGTCCAAACAGTTGCTG
>probe:Drosophila_2:1638342_at:525:197; Interrogation_Position=425; Antisense; AACGAGGACCTGACCAGTAGCGGCG
>probe:Drosophila_2:1638342_at:34:669; Interrogation_Position=465; Antisense; TACTGCCGTACGTGAAGCTTGCCAA
>probe:Drosophila_2:1638342_at:457:221; Interrogation_Position=492; Antisense; AAGTGATCACTCTGACGCTTAAGCC
>probe:Drosophila_2:1638342_at:244:183; Interrogation_Position=530; Antisense; AAAAGCGAGGACATCCAGCTCTACC
>probe:Drosophila_2:1638342_at:107:459; Interrogation_Position=599; Antisense; GATATCACTGAACTAGAGGCTCCCA
>probe:Drosophila_2:1638342_at:296:99; Interrogation_Position=613; Antisense; AGAGGCTCCCAACTTTATCGCTGGA
>probe:Drosophila_2:1638342_at:605:439; Interrogation_Position=670; Antisense; GATGGAATTGCCTGTTACCTCTTTC
>probe:Drosophila_2:1638342_at:548:621; Interrogation_Position=733; Antisense; TGCGCAGCCAGTGATCAAGGTACTT
>probe:Drosophila_2:1638342_at:551:75; Interrogation_Position=804; Antisense; AGGAGAGCTCTTATTTGTACATGTG
>probe:Drosophila_2:1638342_at:199:391; Interrogation_Position=828; Antisense; GAAACTACTTTTGGCTGTGCTCAAC
>probe:Drosophila_2:1638342_at:87:333; Interrogation_Position=841; Antisense; GCTGTGCTCAACTTCCTAGTTTTAA

Paste this into a BLAST search page for me
GCCTCTTCTCTGCTGGAAAAGGATGATGCAAAGCGTGTGTGCGCCATTCCGAGTCATTCGTCCAAACAGTTGCTGAACGAGGACCTGACCAGTAGCGGCGTACTGCCGTACGTGAAGCTTGCCAAAAGTGATCACTCTGACGCTTAAGCCAAAAGCGAGGACATCCAGCTCTACCGATATCACTGAACTAGAGGCTCCCAAGAGGCTCCCAACTTTATCGCTGGAGATGGAATTGCCTGTTACCTCTTTCTGCGCAGCCAGTGATCAAGGTACTTAGGAGAGCTCTTATTTGTACATGTGGAAACTACTTTTGGCTGTGCTCAACGCTGTGCTCAACTTCCTAGTTTTAA

Full Affymetrix probeset data:

Annotations for 1638342_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime