Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638343_at:

>probe:Drosophila_2:1638343_at:175:75; Interrogation_Position=373; Antisense; AGGACGAGGAGCACGCGCTGACCAA
>probe:Drosophila_2:1638343_at:61:611; Interrogation_Position=391; Antisense; TGACCAAGCGATCCGATGAGTCCAC
>probe:Drosophila_2:1638343_at:42:157; Interrogation_Position=423; Antisense; ACAGCTGACGATGGCCTGGCACGCA
>probe:Drosophila_2:1638343_at:659:287; Interrogation_Position=438; Antisense; CTGGCACGCAAGATTCTGCTGCAGA
>probe:Drosophila_2:1638343_at:156:641; Interrogation_Position=452; Antisense; TCTGCTGCAGACCACCAGGAAGGTG
>probe:Drosophila_2:1638343_at:514:599; Interrogation_Position=494; Antisense; TGTACCCGCCCACTTGATTATCGAT
>probe:Drosophila_2:1638343_at:514:15; Interrogation_Position=510; Antisense; ATTATCGATCATGTGTCCGTGCAGC
>probe:Drosophila_2:1638343_at:657:605; Interrogation_Position=592; Antisense; TGATCTCGGCCACCATCAAGGAGGA
>probe:Drosophila_2:1638343_at:218:351; Interrogation_Position=644; Antisense; GCAGACCAAGATTAGCATCACCAAA
>probe:Drosophila_2:1638343_at:593:181; Interrogation_Position=666; Antisense; AAAACATCGATTACGTCCACGGCGC
>probe:Drosophila_2:1638343_at:293:505; Interrogation_Position=680; Antisense; GTCCACGGCGCCAATTGAGAGTGTA
>probe:Drosophila_2:1638343_at:4:583; Interrogation_Position=715; Antisense; TGGCCCTGGCTGGATCTGTGACAAA
>probe:Drosophila_2:1638343_at:463:683; Interrogation_Position=818; Antisense; TATCCTGACCATTGTGAGCAGCTCC
>probe:Drosophila_2:1638343_at:429:141; Interrogation_Position=870; Antisense; ACGGAGGAGCCCATTCAGAAGCTGA

Paste this into a BLAST search page for me
AGGACGAGGAGCACGCGCTGACCAATGACCAAGCGATCCGATGAGTCCACACAGCTGACGATGGCCTGGCACGCACTGGCACGCAAGATTCTGCTGCAGATCTGCTGCAGACCACCAGGAAGGTGTGTACCCGCCCACTTGATTATCGATATTATCGATCATGTGTCCGTGCAGCTGATCTCGGCCACCATCAAGGAGGAGCAGACCAAGATTAGCATCACCAAAAAAACATCGATTACGTCCACGGCGCGTCCACGGCGCCAATTGAGAGTGTATGGCCCTGGCTGGATCTGTGACAAATATCCTGACCATTGTGAGCAGCTCCACGGAGGAGCCCATTCAGAAGCTGA

Full Affymetrix probeset data:

Annotations for 1638343_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime