FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638344_at:

>probe:Drosophila_2:1638344_at:524:669; Interrogation_Position=1014; Antisense; TACTGCTACTTTGCCGGCATGACTT
>probe:Drosophila_2:1638344_at:277:55; Interrogation_Position=1032; Antisense; ATGACTTTCGCCGTGGTTGGAATCC
>probe:Drosophila_2:1638344_at:345:97; Interrogation_Position=1099; Antisense; AGATCCTGAATTTCCTGTACTCCAC
>probe:Drosophila_2:1638344_at:695:351; Interrogation_Position=1127; Antisense; GCAGCTGTTCCACTTTGTGCCATGT
>probe:Drosophila_2:1638344_at:618:429; Interrogation_Position=1212; Antisense; GAGTTTCGCCTGGAGGATCTCAACG
>probe:Drosophila_2:1638344_at:679:529; Interrogation_Position=1241; Antisense; GGGTCGCCTGATGGTCACAGTACTG
>probe:Drosophila_2:1638344_at:75:155; Interrogation_Position=1257; Antisense; ACAGTACTGCGGAACTTGCGACTAA
>probe:Drosophila_2:1638344_at:29:697; Interrogation_Position=1326; Antisense; TTTACGCTCATTAACTTTGTCCTAG
>probe:Drosophila_2:1638344_at:662:415; Interrogation_Position=1371; Antisense; GAGCGAGTGGTCACCCAGATGCTGA
>probe:Drosophila_2:1638344_at:497:593; Interrogation_Position=1396; Antisense; TGGGATTCCAGGTGCTGTGTACACT
>probe:Drosophila_2:1638344_at:320:595; Interrogation_Position=1411; Antisense; TGTGTACACTGATTGCCCTGACCAT
>probe:Drosophila_2:1638344_at:163:611; Interrogation_Position=1429; Antisense; TGACCATACGATATCCACTGGCCAA
>probe:Drosophila_2:1638344_at:212:681; Interrogation_Position=1461; Antisense; TATGCGAAAACGTAGCCCTCGATTT
>probe:Drosophila_2:1638344_at:512:161; Interrogation_Position=981; Antisense; AAATATCCATCGCAGGTGTTTGTTG

Paste this into a BLAST search page for me
TACTGCTACTTTGCCGGCATGACTTATGACTTTCGCCGTGGTTGGAATCCAGATCCTGAATTTCCTGTACTCCACGCAGCTGTTCCACTTTGTGCCATGTGAGTTTCGCCTGGAGGATCTCAACGGGGTCGCCTGATGGTCACAGTACTGACAGTACTGCGGAACTTGCGACTAATTTACGCTCATTAACTTTGTCCTAGGAGCGAGTGGTCACCCAGATGCTGATGGGATTCCAGGTGCTGTGTACACTTGTGTACACTGATTGCCCTGACCATTGACCATACGATATCCACTGGCCAATATGCGAAAACGTAGCCCTCGATTTAAATATCCATCGCAGGTGTTTGTTG

Full Affymetrix probeset data:

Annotations for 1638344_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720