FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638345_at:

>probe:Drosophila_2:1638345_at:328:515; Interrogation_Position=2559; Antisense; GTGTTATTGCAACTGCTTTCTTTTT
>probe:Drosophila_2:1638345_at:63:93; Interrogation_Position=2630; Antisense; AGTTTTATATGTGAGCGCTGCTGTC
>probe:Drosophila_2:1638345_at:211:501; Interrogation_Position=2652; Antisense; GTCGCTGTTGCGAGCCTTAGCAATA
>probe:Drosophila_2:1638345_at:190:17; Interrogation_Position=2676; Antisense; ATTTCATTGTGATTACTTAGGCATA
>probe:Drosophila_2:1638345_at:118:493; Interrogation_Position=2787; Antisense; GTAACTCATATATTCATTGTGCGTA
>probe:Drosophila_2:1638345_at:276:689; Interrogation_Position=2797; Antisense; TATTCATTGTGCGTACAGTCTGAGC
>probe:Drosophila_2:1638345_at:333:267; Interrogation_Position=2812; Antisense; CAGTCTGAGCATTTGTTGTATATAC
>probe:Drosophila_2:1638345_at:669:389; Interrogation_Position=2846; Antisense; GAAACCTTTCAAATCCAAGCATTTT
>probe:Drosophila_2:1638345_at:452:251; Interrogation_Position=2861; Antisense; CAAGCATTTTTAACGCATCTACTGA
>probe:Drosophila_2:1638345_at:409:389; Interrogation_Position=2884; Antisense; GAAACAACACGTGTATCTATACCTA
>probe:Drosophila_2:1638345_at:663:681; Interrogation_Position=2901; Antisense; TATACCTAGCATGTAAGCGCAACAG
>probe:Drosophila_2:1638345_at:198:123; Interrogation_Position=2916; Antisense; AGCGCAACAGTTATGCTAACCATTG
>probe:Drosophila_2:1638345_at:377:51; Interrogation_Position=3002; Antisense; ATGCGTTTCGATCCATTAACTCAAA
>probe:Drosophila_2:1638345_at:1:269; Interrogation_Position=3056; Antisense; CAGGCAACCAGCATGTTTTTGTCAA

Paste this into a BLAST search page for me
GTGTTATTGCAACTGCTTTCTTTTTAGTTTTATATGTGAGCGCTGCTGTCGTCGCTGTTGCGAGCCTTAGCAATAATTTCATTGTGATTACTTAGGCATAGTAACTCATATATTCATTGTGCGTATATTCATTGTGCGTACAGTCTGAGCCAGTCTGAGCATTTGTTGTATATACGAAACCTTTCAAATCCAAGCATTTTCAAGCATTTTTAACGCATCTACTGAGAAACAACACGTGTATCTATACCTATATACCTAGCATGTAAGCGCAACAGAGCGCAACAGTTATGCTAACCATTGATGCGTTTCGATCCATTAACTCAAACAGGCAACCAGCATGTTTTTGTCAA

Full Affymetrix probeset data:

Annotations for 1638345_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720