Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638349_s_at:

>probe:Drosophila_2:1638349_s_at:520:373; Interrogation_Position=195; Antisense; GAAGTCGCGGCCATGCAAGATTGTC
>probe:Drosophila_2:1638349_s_at:72:217; Interrogation_Position=211; Antisense; AAGATTGTCGAGATGTCTACTTCAA
>probe:Drosophila_2:1638349_s_at:303:173; Interrogation_Position=243; Antisense; AAAGCACGGACACGCCAAGGTTCAT
>probe:Drosophila_2:1638349_s_at:263:541; Interrogation_Position=270; Antisense; GGTTGGCATTGATATTTTCTCTAAC
>probe:Drosophila_2:1638349_s_at:670:19; Interrogation_Position=310; Antisense; ATTTGCCCATCTACTCATAACATGG
>probe:Drosophila_2:1638349_s_at:277:549; Interrogation_Position=354; Antisense; GGAGGACCTTCAGTTGATTGCTATT
>probe:Drosophila_2:1638349_s_at:88:511; Interrogation_Position=380; Antisense; GTGACGATAGCTTCCTTACATTGAT
>probe:Drosophila_2:1638349_s_at:290:103; Interrogation_Position=410; Antisense; AGAGCGGAGATCTGCGTGAAGACTT
>probe:Drosophila_2:1638349_s_at:650:145; Interrogation_Position=431; Antisense; ACTTGAAGGTTCCAGAGGGCGAATT
>probe:Drosophila_2:1638349_s_at:705:583; Interrogation_Position=486; Antisense; TGGCAAGGACTTACTGTGCACCGTT
>probe:Drosophila_2:1638349_s_at:165:355; Interrogation_Position=503; Antisense; GCACCGTTCTCAAGGCGTGCGGAGA
>probe:Drosophila_2:1638349_s_at:492:515; Interrogation_Position=581; Antisense; GTGTCGCTGTAAATTTCTGTTGCAT
>probe:Drosophila_2:1638349_s_at:690:327; Interrogation_Position=635; Antisense; GCTGTTATAGGCTAGTTGGCTCTAC
>probe:Drosophila_2:1638349_s_at:639:341; Interrogation_Position=649; Antisense; GTTGGCTCTACATCTTAAATCTGGT

Paste this into a BLAST search page for me
GAAGTCGCGGCCATGCAAGATTGTCAAGATTGTCGAGATGTCTACTTCAAAAAGCACGGACACGCCAAGGTTCATGGTTGGCATTGATATTTTCTCTAACATTTGCCCATCTACTCATAACATGGGGAGGACCTTCAGTTGATTGCTATTGTGACGATAGCTTCCTTACATTGATAGAGCGGAGATCTGCGTGAAGACTTACTTGAAGGTTCCAGAGGGCGAATTTGGCAAGGACTTACTGTGCACCGTTGCACCGTTCTCAAGGCGTGCGGAGAGTGTCGCTGTAAATTTCTGTTGCATGCTGTTATAGGCTAGTTGGCTCTACGTTGGCTCTACATCTTAAATCTGGT

Full Affymetrix probeset data:

Annotations for 1638349_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime