FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638350_at:

>probe:Drosophila_2:1638350_at:212:535; Interrogation_Position=1065; Antisense; GGTGACGTTCCACAATCAGCGAGAT
>probe:Drosophila_2:1638350_at:99:429; Interrogation_Position=1085; Antisense; GAGATTACATATTCTTCCGTCACCA
>probe:Drosophila_2:1638350_at:199:259; Interrogation_Position=1108; Antisense; CACCGCTACGAGTTCACCAAAGAGG
>probe:Drosophila_2:1638350_at:411:179; Interrogation_Position=1177; Antisense; AAACTACGTTCCCTGCAGGAGGGCA
>probe:Drosophila_2:1638350_at:676:149; Interrogation_Position=1201; Antisense; ACATTCGACAGCAAGACCGGTGACT
>probe:Drosophila_2:1638350_at:9:413; Interrogation_Position=1215; Antisense; GACCGGTGACTATGCCTGGATAATC
>probe:Drosophila_2:1638350_at:520:239; Interrogation_Position=1236; Antisense; AATCAGCAACAAACGGCACGCCATG
>probe:Drosophila_2:1638350_at:200:343; Interrogation_Position=1274; Antisense; GCTTCTTCCTCTAGGTGTATTTCGA
>probe:Drosophila_2:1638350_at:714:427; Interrogation_Position=802; Antisense; GAGTTCACAGACGTCGTGATCGTTA
>probe:Drosophila_2:1638350_at:20:231; Interrogation_Position=847; Antisense; AATGGGCTGCTGGTCATTCATCTGC
>probe:Drosophila_2:1638350_at:512:139; Interrogation_Position=905; Antisense; ACGTGAAGCTCACCTCGGACATAAA
>probe:Drosophila_2:1638350_at:623:93; Interrogation_Position=944; Antisense; AGATAACCAAGCACAGGCCCGAAGT
>probe:Drosophila_2:1638350_at:163:577; Interrogation_Position=959; Antisense; GGCCCGAAGTGATCCTGAACAATTT
>probe:Drosophila_2:1638350_at:323:705; Interrogation_Position=983; Antisense; TTACCACACGTTTGGGTCTGACCGT

Paste this into a BLAST search page for me
GGTGACGTTCCACAATCAGCGAGATGAGATTACATATTCTTCCGTCACCACACCGCTACGAGTTCACCAAAGAGGAAACTACGTTCCCTGCAGGAGGGCAACATTCGACAGCAAGACCGGTGACTGACCGGTGACTATGCCTGGATAATCAATCAGCAACAAACGGCACGCCATGGCTTCTTCCTCTAGGTGTATTTCGAGAGTTCACAGACGTCGTGATCGTTAAATGGGCTGCTGGTCATTCATCTGCACGTGAAGCTCACCTCGGACATAAAAGATAACCAAGCACAGGCCCGAAGTGGCCCGAAGTGATCCTGAACAATTTTTACCACACGTTTGGGTCTGACCGT

Full Affymetrix probeset data:

Annotations for 1638350_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720