FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638352_at:

>probe:Drosophila_2:1638352_at:365:45; Interrogation_Position=2728; Antisense; ATCGCGAGGAAGAGCGCATCACCTG
>probe:Drosophila_2:1638352_at:430:311; Interrogation_Position=2752; Antisense; GCCAACGGAAAATGCTGCTCACCTA
>probe:Drosophila_2:1638352_at:474:127; Interrogation_Position=2776; Antisense; ACCAAATGGAGGTGCGTCGGCGCAA
>probe:Drosophila_2:1638352_at:47:577; Interrogation_Position=2794; Antisense; GGCGCAAGAGCGAGGTCATCACTAA
>probe:Drosophila_2:1638352_at:568:153; Interrogation_Position=2822; Antisense; ACAGGAGTCTGAGCAGCGACGCAAA
>probe:Drosophila_2:1638352_at:482:609; Interrogation_Position=2897; Antisense; TGAGCGTCGGCGTCACAACCAAGAA
>probe:Drosophila_2:1638352_at:145:77; Interrogation_Position=2953; Antisense; AGGAGATGGAGCTCCTTGCCCAGCG
>probe:Drosophila_2:1638352_at:230:259; Interrogation_Position=2973; Antisense; CAGCGCTACTACTCGGATACGGAGG
>probe:Drosophila_2:1638352_at:113:533; Interrogation_Position=2996; Antisense; GGGTGCTCCACTGGCACAGAAGTAT
>probe:Drosophila_2:1638352_at:280:49; Interrogation_Position=3030; Antisense; ATCCAGAAACTTTGCTATCAGCGTG
>probe:Drosophila_2:1638352_at:33:183; Interrogation_Position=3067; Antisense; AAAACTTGCGTGATATGACCATGGA
>probe:Drosophila_2:1638352_at:343:57; Interrogation_Position=3081; Antisense; ATGACCATGGAACAGCTGCGAACTC
>probe:Drosophila_2:1638352_at:433:271; Interrogation_Position=3112; Antisense; CATCATCTGTGCAATTTAGTCCCCA
>probe:Drosophila_2:1638352_at:496:701; Interrogation_Position=3127; Antisense; TTAGTCCCCAGCTGGTGGATATCGA

Paste this into a BLAST search page for me
ATCGCGAGGAAGAGCGCATCACCTGGCCAACGGAAAATGCTGCTCACCTAACCAAATGGAGGTGCGTCGGCGCAAGGCGCAAGAGCGAGGTCATCACTAAACAGGAGTCTGAGCAGCGACGCAAATGAGCGTCGGCGTCACAACCAAGAAAGGAGATGGAGCTCCTTGCCCAGCGCAGCGCTACTACTCGGATACGGAGGGGGTGCTCCACTGGCACAGAAGTATATCCAGAAACTTTGCTATCAGCGTGAAAACTTGCGTGATATGACCATGGAATGACCATGGAACAGCTGCGAACTCCATCATCTGTGCAATTTAGTCCCCATTAGTCCCCAGCTGGTGGATATCGA

Full Affymetrix probeset data:

Annotations for 1638352_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720