FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638354_at:

>probe:Drosophila_2:1638354_at:145:721; Interrogation_Position=1279; Antisense; TTGAGCCGGACAGCAAGTGGACCCT
>probe:Drosophila_2:1638354_at:502:83; Interrogation_Position=1294; Antisense; AGTGGACCCTACTAACAAGTGCCCT
>probe:Drosophila_2:1638354_at:667:219; Interrogation_Position=1310; Antisense; AAGTGCCCTTCTAATGCGTGCTATC
>probe:Drosophila_2:1638354_at:46:509; Interrogation_Position=1327; Antisense; GTGCTATCGATTTCTCAGCCAATCA
>probe:Drosophila_2:1638354_at:360:29; Interrogation_Position=1348; Antisense; ATCACGAAACGAGCTTGGCGCACTT
>probe:Drosophila_2:1638354_at:576:79; Interrogation_Position=1405; Antisense; AGGGTTACTACAAGGACCTCGCTGC
>probe:Drosophila_2:1638354_at:500:129; Interrogation_Position=1420; Antisense; ACCTCGCTGCTAGGTGGACCTTGGA
>probe:Drosophila_2:1638354_at:296:639; Interrogation_Position=1470; Antisense; TCGGCCGACTTTCCCAAAAGATTTG
>probe:Drosophila_2:1638354_at:197:369; Interrogation_Position=1502; Antisense; GAATGCCGTACTGCTGGAATCGCTT
>probe:Drosophila_2:1638354_at:364:563; Interrogation_Position=1517; Antisense; GGAATCGCTTCCTTATGATCAATAC
>probe:Drosophila_2:1638354_at:44:661; Interrogation_Position=1561; Antisense; TAACCTTGCCCAACAAACTGCGAGA
>probe:Drosophila_2:1638354_at:230:367; Interrogation_Position=1596; Antisense; GAATCAGTGCCCAAAACGTTTGCAG
>probe:Drosophila_2:1638354_at:164:273; Interrogation_Position=1682; Antisense; CATTTGGTGCTGAACCGTTTTTGGT
>probe:Drosophila_2:1638354_at:263:691; Interrogation_Position=1761; Antisense; TATTCCTATTTATTCCTTGTACGAG

Paste this into a BLAST search page for me
TTGAGCCGGACAGCAAGTGGACCCTAGTGGACCCTACTAACAAGTGCCCTAAGTGCCCTTCTAATGCGTGCTATCGTGCTATCGATTTCTCAGCCAATCAATCACGAAACGAGCTTGGCGCACTTAGGGTTACTACAAGGACCTCGCTGCACCTCGCTGCTAGGTGGACCTTGGATCGGCCGACTTTCCCAAAAGATTTGGAATGCCGTACTGCTGGAATCGCTTGGAATCGCTTCCTTATGATCAATACTAACCTTGCCCAACAAACTGCGAGAGAATCAGTGCCCAAAACGTTTGCAGCATTTGGTGCTGAACCGTTTTTGGTTATTCCTATTTATTCCTTGTACGAG

Full Affymetrix probeset data:

Annotations for 1638354_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720