Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638360_at:

>probe:Drosophila_2:1638360_at:346:597; Interrogation_Position=1849; Antisense; TGTCGGCTACACTGAGATGCGTTCA
>probe:Drosophila_2:1638360_at:442:453; Interrogation_Position=1878; Antisense; GATCAGCGATCATTTGCGTTGGGTT
>probe:Drosophila_2:1638360_at:51:129; Interrogation_Position=1932; Antisense; ACCATACCAGCTCCATTGATTTTCG
>probe:Drosophila_2:1638360_at:607:15; Interrogation_Position=1950; Antisense; ATTTTCGGAGCCCTGATCGACGAAT
>probe:Drosophila_2:1638360_at:75:41; Interrogation_Position=1965; Antisense; ATCGACGAATCCTGCATTTTGTGGC
>probe:Drosophila_2:1638360_at:638:133; Interrogation_Position=2008; Antisense; ACGCCGGAGGAGCTTGTCTAGTCTA
>probe:Drosophila_2:1638360_at:672:583; Interrogation_Position=2061; Antisense; TGGCTACTGGCGTTGATCTGCAAAC
>probe:Drosophila_2:1638360_at:132:357; Interrogation_Position=2080; Antisense; GCAAACTGGGATCCGTGGTCTTTTT
>probe:Drosophila_2:1638360_at:651:721; Interrogation_Position=2108; Antisense; TTGCGCCTGGTGGTTTTATGTGCCA
>probe:Drosophila_2:1638360_at:691:597; Interrogation_Position=2126; Antisense; TGTGCCACCCAGTAAGCCATTGAAT
>probe:Drosophila_2:1638360_at:149:687; Interrogation_Position=2211; Antisense; TATAATGATCCAGCCAGCCATTTGG
>probe:Drosophila_2:1638360_at:211:721; Interrogation_Position=2232; Antisense; TTGGCTCATATTGTGGCTCATCATA
>probe:Drosophila_2:1638360_at:269:121; Interrogation_Position=2257; Antisense; AGCTGGCTAGCATTTTTATTCGATT
>probe:Drosophila_2:1638360_at:590:461; Interrogation_Position=2333; Antisense; GATTCAGCTCATAATGCCACTTAAG

Paste this into a BLAST search page for me
TGTCGGCTACACTGAGATGCGTTCAGATCAGCGATCATTTGCGTTGGGTTACCATACCAGCTCCATTGATTTTCGATTTTCGGAGCCCTGATCGACGAATATCGACGAATCCTGCATTTTGTGGCACGCCGGAGGAGCTTGTCTAGTCTATGGCTACTGGCGTTGATCTGCAAACGCAAACTGGGATCCGTGGTCTTTTTTTGCGCCTGGTGGTTTTATGTGCCATGTGCCACCCAGTAAGCCATTGAATTATAATGATCCAGCCAGCCATTTGGTTGGCTCATATTGTGGCTCATCATAAGCTGGCTAGCATTTTTATTCGATTGATTCAGCTCATAATGCCACTTAAG

Full Affymetrix probeset data:

Annotations for 1638360_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime